Acupalpus brunnipes

(Sturm, 1825) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Carabidae/Acupalpus

At a glance

Occurrence records490

Data sources6

Biological traits2

DNA specimens6

eDNA detections6

Sources6 archives

Databases and archives Acupalpus brunnipes's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility490 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF490 records

Environmental DNA1 datasets · 3 countries6 detections

DNA & barcodingBOLD6 specimens

01Narrative

Acupalpus brunnipes is a ground beetle in the family Carabidae, found in the Palearctic, in northern and western Europe, Greece, and North Africa. It typically lives among moss and litter near water. Like most ground beetles, Acupalpus brunnipes is a predator.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)predator

Feeding guild (larval)predator

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acupalpus brunnipes has left across the world's sequence archives.

At a glance

DNA specimens6

BINs1

Marker genes1

eDNA detections6

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.41%

Haplotypes1

BIN1

Where individuals differ — all 6 variable positions, in barcode order

2Amostly conserved

74Gvariable

179Amostly conserved

314Gvariable

524Cvariable

629Gmostly conserved

CATTATATTTTATTTTCGGAGTATGAGCTGGTATAGTAGGAACTTCTTTAAGCATATTAATTCGAGCTGAATTGGGAACTCCTGGAGCAT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acupalpus maculatussame genus5.6%Acupalpus parvulussame genus6.1%Acupalpus eleganssame genus6.3%Acupalpus luteatussame genus6.9%Acupalpus pumilussame genus7.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type490 records

Wild obs. + sensor392

Museum / vouchered93

Fossil4

Other1

Origin

Native4

Range

Area of Occupancy AOO880 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy62% within 1 km

≤100 m 49≤1 km 168≤10 km 128>10 km 4

349 georeferenced · 43 without coordinates

Open the mapobservation + sensor392

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤100 m 14≤1 km 16≤10 km 49>10 km 1

80 georeferenced · 13 without coordinates

Open the institutions mapphysical evidence93

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tilburg, NL	27
SLU Artdatabankenlocation not on record	7
Natural History Museum Rotterdamlocation not on record	5
ZSMlocation not on record	4
Uniwersytet Wrocławskilocation not on record	4
MZLUlocation not on record	3
IFR-DNFlocation not on record	2
Bern, CH	2
Paris, FR	2
Geneva, CH	2
CBDClocation not on record	1
Vitoria, ES	1
Ugentlocation not on record	1

13 institutions · 61 of 93 vouchered records shown · 32 without an institution code

09Environmental DNA6 detections

Where the DNA of Acupalpus brunnipes was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map3 countries0

1. Forest & Woodland | 1.4. Temperate Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.4 °C 13.9–17.9

Seasonal swing summer↔winter13.6 °C

Max temp (day)18.8 °C 16.2–22.0

Min temp (night)13.0 °C 10.6–15.8

Precipitation73.3 mm/mo 39.8–127

Air humidity60.9 % 57.6–62.2

Moisture balance-59.9 mm/mo -112–19.0

Vapour deficit751 Pa 621–872

Wind speed3.40 m/s 3.20–5.00

Cloud cover40.4 % 37.4–42.5

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)