Acupalpus elegans

(Dejean, 1829) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Carabidae/Acupalpus

At a glance

Occurrence records270

Data sources7

Biological traits0

DNA specimens17

eDNA detections17

Sources7 archives

Databases and archives Acupalpus elegans's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility270 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI17 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics17 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF270 records

Environmental DNA1 datasets · 3 countries17 detections

DNA & barcodingBOLD17 specimens

Genome at a glanceTreeOfSex2n = 22

01Narrative

Acupalpus elegans is an insect-eating ground beetle in the genus Acupalpus.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding17 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acupalpus elegans has left across the world's sequence archives.

At a glance

DNA specimens17

BINs1

Marker genes2

eDNA detections17

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus15 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

312Gmostly conserved

313Cmostly conserved

382Amostly conserved

631Tmostly conserved

AACATTATATTTTATTTTTGGAGTATGAGCAGGTATAGTAGGGACTTCTTTAAGAATATTAATTCGAGCTGAATTAGGAACTCCTGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.12%

Haplotypes4

BIN1

Most divergent pair0.30%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acupalpus parvulussame genus2.1%Acupalpus maculatussame genus3.3%Amblygnathus iripennissame family5.6%Amblygnathus mexicanussame family5.6%Amblygnathus puncticollissame family5.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

06Genome at a glanceTreeOfSex

The complete instruction manual Acupalpus elegans carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 221×TreeOfSex · invert

TreeOfSex · invert — Rozek M, Rudek Z (1992) Karyotype analysis and C-banding pattern in two species of carabid (Coleoptera, Carabidae). Folia biologica 40: 47. ↗

08Occurrence & distribution

Record type270 records

Wild obs. + sensor157

Museum / vouchered100

Fossil1

Other12

Origin

Native6

Range

Area of Occupancy AOO540 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy62% within 1 km

≤100 m 56≤1 km 23≤10 km 41>10 km 7

127 georeferenced · 30 without coordinates

Open the mapobservation + sensor157

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy49% within 1 km

≤100 m 1≤1 km 38≤10 km 37>10 km 4

80 georeferenced · 20 without coordinates

Open the institutions mapphysical evidence100

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Natural History Museum Rotterdamlocation not on record	20
Vitoria, ES	16
Provincia di Livornolocation not on record	12
NMOKlocation not on record	7
Uniwersytet Wrocławskilocation not on record	6
IMEDEAlocation not on record	5
Helsinki, FI	3
ZSMlocation not on record	2
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	2
Paris, FR	1
NTNU-VMlocation not on record	1

11 institutions · 75 of 100 vouchered records shown · 25 without an institution code

09Environmental DNA17 detections

Where the DNA of Acupalpus elegans was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found17

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 17 detections have coordinates

Open the map3 countries0

SalzhaldeSalzstelleSaulaie

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.80 °C 0.9–18.4

Seasonal swing summer↔winter18.2 °C

Max temp (day)13.6 °C 3.20–22.5

Min temp (night)7.00 °C -1.80–14.0

Precipitation36.7 mm/mo 32.9–73.4

Air humidity60.7 % 57.7–65.6

Moisture balance-16.3 mm/mo -57.1–14.6

Vapour deficit476 Pa 230–897

Wind speed3.60 m/s 3.20–4.10

Cloud cover41.8 % 32.1–53.4

CHELSA 1981–2010, ~9 km grid, at location & month of 15 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)