Amblygnathus iripennis

(Say, 1823) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Carabidae/Amblygnathus

At a glance

Occurrence records128

Data sources7

Biological traits0

DNA specimens5

eDNA detections2

Sources7 archives

Databases and archives Amblygnathus iripennis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility128 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF128 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD5 specimens

01Narrative

Amblygnathus iripennis is een keversoort uit de familie van de loopkevers (Carabidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1823 door Say.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amblygnathus iripennis has left across the world's sequence archives.

At a glance

DNA specimens5

BINs2

Marker genes1

eDNA detections2

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Diversity (π)2.4%

Haplotypes2

BINs2

Most divergent pair2.9%

Where individuals differ — all 20 variable positions, in barcode order

4Avariable

34Avariable

43Avariable

59Cvariable

145Cvariable

154Cvariable

232Avariable

265Avariable

268Tvariable

307Avariable

376Avariable

382Avariable

415Tvariable

451Tvariable

496Avariable

520Avariable

539Cvariable

547Tvariable

568Avariable

628Gvariable

AACATTATATTTTATTTTTGGAGCATGATCAGGAATAGTAGGAACTTCTTTAAGTATACTAATTCGAGCTGAATTAGGAACTCCTGGTGC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amblygnathus mexicanussame genus2.3%Amblygnathus puncticollissame genus3.2%Selenophorus aequinoctialissame family5.3%Selenophorus famulussame family5.5%Harpalus attenuatussame family5.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type128 records

Wild obs. + sensor2

Museum / vouchered126

Range

Area of Occupancy AOO140 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 125 without coordinates

Open the institutions mapphysical evidence126

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Central Floridalocation not on record	93
University of Alberta Museums (UAM)location not on record	15
Washington, US	8
CUlocation not on record	5
Tempe, US	2
OSUClocation not on record	1
Smithsonian Institution, National Museum of Natural Historylocation not on record	1
EWIClocation not on record	1

8 institutions · 126 of 126 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Amblygnathus iripennis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

Pine barrens

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.2 °C 24.2–24.2

Seasonal swing summer↔winter13.2 °C

Max temp (day)30.0 °C

Min temp (night)19.4 °C

Precipitation93.8 mm/mo

Air humidity58.0 %

Moisture balance-62.3 mm/mo

Vapour deficit1,263 Pa

Wind speed2.10 m/s

Cloud cover34.0 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)