Acupalpus indistinctus

Dejean, 1831 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Carabidae/Acupalpus

At a glance

Occurrence records88

Data sources7

Biological traits0

DNA specimens7

eDNA detections1

Sources7 archives

Databases and archives Acupalpus indistinctus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility88 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF88 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD7 specimens

01Narrative

Acupalpus indistinctus is an insect-eating ground beetle of the genus Acupalpus. The species was first described by Dejean in 1831.Includes images.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acupalpus indistinctus has left across the world's sequence archives.

At a glance

DNA specimens7

BINs1

Marker genes1

eDNA detections1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 10 variable positions, in barcode order

59Cvariable

181Gmostly conserved

211Amostly conserved

235Cvariable

313Cmostly conserved

340Tmostly conserved

496Gvariable

562Avariable

613Tmostly conserved

616Tmostly conserved

AACATTATATTTTATTTTTGGTGTGTGAGCAGGTATAGTAGGAACTTCTTTAAGTATACTAATTCGAGCTGAATTAGGAACTCCTGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.73%

Haplotypes4

BIN1

Most divergent pair1.1%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acupalpus testaceussame genus3.6%Acupalpus partiariussame genus4.1%Acupalpus pauperculussame genus4.3%Acupalpus eleganssame genus6.5%Acupalpus maculatussame genus6.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type88 records

Wild obs. + sensor8

Museum / vouchered80

Range

Area of Occupancy AOO172 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 5≤1 km 2>10 km 1

8 georeferenced

Open the mapobservation + sensor8

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy26% within 1 km

≤100 m 2≤1 km 8≤10 km 25>10 km 4

39 georeferenced · 41 without coordinates

Open the institutions mapphysical evidence80

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University Park, US	16
College Station, US	12
Sam Noble Oklahoma Museum of Natural Historylocation not on record	9
Lexington, US	9
University of Alberta Museums (UAM)location not on record	8
CUlocation not on record	6
Universidad Católica de Manizaleslocation not on record	6
University of Guelphlocation not on record	3
Tempe, US	3
Colorado State Universitylocation not on record	2
EWIClocation not on record	2
Provo, US	1
Lubbock, US	1
ASUlocation not on record	1
UDlocation not on record	1

15 institutions · 80 of 80 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Acupalpus indistinctus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

Sandy beach

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)