Acupalpus dubius

Schilsky, 1888 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Carabidae/Acupalpus

At a glance

Occurrence records7 006

Data sources8

Biological traits2

DNA specimens32

eDNA detections29

Sources8 archives

Databases and archives Acupalpus dubius's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility7 006 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI29 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics32 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF7 006 records

Environmental DNA1 datasets · 4 countries29 detections

DNA & barcodingBOLD32 specimens

Genome at a glanceGoaT · NCBI≈656 Mbp

01Narrative

Acupalpus dubius is an insect-eating ground beetle of the Acupalpus genus.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)predator

Feeding guild (larval)predator

05DNA & barcoding32 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acupalpus dubius has left across the world's sequence archives.

At a glance

DNA specimens32

BINs1

Marker genes2

eDNA detections29

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus25 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

389Avariable

496Avariable

AACATTATATTTTATTTTTGGAGTATGAGCAGGAATAGTTGGAACTTCTTTAAGAATGTTAATTCGAGCAGAATTAGGAACTCCTGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.18%

Haplotypes4

BIN1

Most divergent pair0.61%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acupalpus luteatussame genus5.3%Acupalpus pumilussame genus6.4%Acupalpus exiguussame genus6.4%Acupalpus hydropicussame genus6.5%Acupalpus nanellussame genus6.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Acupalpus dubius carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈656 065 276 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Acupalpus dubius0.66 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness96.8% BUSCO

08Occurrence & distribution

Record type7 006 records

Wild obs. + sensor5 853

Museum / vouchered1 138

Cultivated / captive1

Fossil12

Other2

Origin

Native210

Range

Area of Occupancy AOO8 680 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 2 436≤1 km 1 848≤10 km 1 394>10 km 2

5 680 georeferenced · 173 without coordinates

Open the mapobservation + sensor5 853

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy66% within 1 km

≤100 m 40≤1 km 678≤10 km 359>10 km 4

1 081 georeferenced · 57 without coordinates

Open the institutions mapphysical evidence1 138

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 32 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Vitoria, ES	603
Geneva, CH	61
Philadelphia, US	34
SLU Artdatabankenlocation not on record	32
Natural History Museum Rotterdamlocation not on record	22
Tilburg, NL	18
Copenhagen, DK	16
UAclocation not on record	15
Musee d'Histoire Naturallelocation not on record	12
ZSMlocation not on record	12
LEBAlocation not on record	11
Muzeum Górnośląskie w Bytomiulocation not on record	10
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	9
Frauenfeld, CH	6
Bern, CH	6
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	6
CBDClocation not on record	6
Naturmuseum Solothurnlocation not on record	4
Uniwersytet Wrocławskilocation not on record	4
Zürich, CH	4
Ghent, BE	2
Helsinki, FI	2
Forschungsinstitut für biologischen Landbau Frick \| Research Institute of Organic Agriculture Fricklocation not on record	2
Zoologisches Forschungsmuseum Alexander Koeniglocation not on record	2
Natural History Museum, Londonlocation not on record	2
SFRAlocation not on record	2
South Kensington, GB	2
Naturalis Biodiversity Centerlocation not on record	1
Paro, BT	1
Tartu, EE	1
NCMGlocation not on record	1
MZLUlocation not on record	1

32 institutions · 910 of 1 138 vouchered records shown · 228 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA29 detections

Where the DNA of Acupalpus dubius was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found29

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 29 detections have coordinates

Open the map4 countries0

auf einer Sumpfwiese in einer Lichtfallein einem Garten in einer Lichtfalle1. Forest & Woodland | 1.4. Temperate ForestTeichuferTeich

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.0 °C 4.10–18.6

Seasonal swing summer↔winter16.3 °C

Max temp (day)16.2 °C 7.70–22.6

Min temp (night)9.20 °C 0.7–14.0

Precipitation67.8 mm/mo 45.2–76.7

Air humidity59.8 % 58.2–64.1

Moisture balance-33.6 mm/mo -63.1–10.8

Vapour deficit528 Pa 309–878

Wind speed3.50 m/s 3.20–5.10

Cloud cover39.5 % 34.2–45.6

CHELSA 1981–2010, ~9 km grid, at location & month of 27 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acupalpus dubius

At a glance

Sources8 archives

Diet & foraging2

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type7 006 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions13 of 32 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type7 006 records