Acupalpus exiguus

Dejean, 1829 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Carabidae/Acupalpus

At a glance

Occurrence records1 695

Data sources6

Biological traits2

DNA specimens24

eDNA detections34

Sources6 archives

Databases and archives Acupalpus exiguus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 695 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI34 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics24 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF1 695 records

Environmental DNA4 datasets · 7 countries34 detections

DNA & barcodingBOLD24 specimens

01Narrative

Acupalpus exiguus is a species of ground beetle in the family Carabidae, found in the Palearctic.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)predator

Feeding guild (larval)predator

05DNA & barcoding24 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acupalpus exiguus has left across the world's sequence archives.

At a glance

DNA specimens24

BINs1

Marker genes2

eDNA detections34

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus21 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 1 variable positions, in barcode order

328Gmostly conserved

AACATTATATTTTATTTTTGGAGTATGAGCAGGAATAGTGGGAACTTCTTTAAGAATATTAATTCGAGCAGAATTAGGAACCCCTGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.19%

Haplotypes10

BIN1

Most divergent pair0.61%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acupalpus luteatussame genus5.9%Acupalpus dubiussame genus6.4%Acupalpus pauperculussame genus6.7%Acupalpus interstitialissame genus6.8%Acupalpus maculatussame genus6.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type1 695 records

Wild obs. + sensor1 099

Museum / vouchered551

Cultivated / captive1

Fossil22

Other22

Origin

Native24

Range

Area of Occupancy AOO3 196 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 406≤1 km 307≤10 km 297

1 010 georeferenced · 89 without coordinates

Open the mapobservation + sensor1 099

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy34% within 1 km

≤100 m 58≤1 km 96≤10 km 262>10 km 33

449 georeferenced · 102 without coordinates

Open the institutions mapphysical evidence551

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 33 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	99
Helsinki, FI	41
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	27
NCMGlocation not on record	12
Adam Mickiewicz University in Poznańlocation not on record	12
Natural History Museum Rotterdamlocation not on record	11
Copenhagen, DK	11
Geneva, CH	10
Tallinn, EE	9
Uniwersytet Wrocławskilocation not on record	8
MZLUlocation not on record	8
Muzeum Górnośląskie w Bytomiulocation not on record	5
Bern, CH	4
ZMAAlocation not on record	4
Metsähallituslocation not on record	4
LEBAlocation not on record	4
IFR-DNFlocation not on record	3
ZSMlocation not on record	3
Kuopio, FI	3
Provincia di Livornolocation not on record	2
Oulu, FI	2
Tilburg, NL	2
Natural History Museum, Londonlocation not on record	2
TMPMlocation not on record	2
Zoological Museum of the University of Chittagong, Bangladeshlocation not on record	2
Forschungsinstitut für biologischen Landbau Frick \| Research Institute of Organic Agriculture Fricklocation not on record	2
CBDClocation not on record	1
LSMlocation not on record	1
NTNU-VMlocation not on record	1
Tartu, EE	1
Salzburg, AT	1
Paris, FR	1
IPEM TASlocation not on record	1

33 institutions · 299 of 551 vouchered records shown · 252 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA34 detections

Where the DNA of Acupalpus exiguus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found34

Studies independent surveys4

Countries7

Verifiable raw sequence linked3

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 34 detections have coordinates

Open the map7 countries0

pellon ja rahkasammalluhdan reunaStauseeufermerenrantaniitty

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.8 °C 2.70–17.6

Seasonal swing summer↔winter15.8 °C

Max temp (day)14.9 °C 5.60–21.6

Min temp (night)9.10 °C -0.1–12.6

Precipitation58.6 mm/mo 45.9–72.1

Air humidity60.7 % 57.7–65.8

Moisture balance-57.2 mm/mo -62.7–27.7

Vapour deficit522 Pa 256–848

Wind speed4.30 m/s 2.70–5.30

Cloud cover40.0 % 36.6–51.6

CHELSA 1981–2010, ~9 km grid, at location & month of 33 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acupalpus exiguus

At a glance

Sources6 archives

Diet & foraging2

At a glance

Record type1 695 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions11 of 33 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 695 records