Acroteriobatus variegatus

(Nair & Lal Mohan, 1973) · species

image placeholder — illustration coming later

Animalia/Chordata/Elasmobranchii/Rhinopristiformes/Rhinobatidae/Acroteriobatus

At a glance

Occurrence records20

Data sources8

Biological traits6

DNA specimens11

eDNA detections0

Sources8 archives

Databases and archives Acroteriobatus variegatus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility12 records↗

OBISOcean Biodiversity Information System8 records↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF · OBIS20 records

DNA & barcodingBOLD11 specimens

01Narrative

The stripenose guitarfish (Acroteriobatus variegatus) is a species of fish in the Rhinobatidae family endemic to the eastern coast of India, and Sri Lanka. Its natural habitat is in the neritic zone.Kyne, P.M., Simpfendorfer, C., Bineesh, K.K., Moore, A., Jabado, R.W. & Valinassab, T. 2017. Acroteriobatus variegatus. The IUCN Red List of Threatened Species 2017: e.T161476A109905030. https://dx.doi.org/10.2305/IUCN.UK.2017-2.RLTS.T161476A109905030.en. Accessed on 05 February 2022.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length75 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonedemersal

Other traits3

Depth max40 m

Depth min10 m

Vulnerability50

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acroteriobatus variegatus has left across the world's sequence archives.

At a glance

DNA specimens11

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P661 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

8Tmostly conserved

98Gvariable

197Gmostly conserved

221Gvariable

380Gvariable

643Cmostly conserved

CCTTTATTTGATCTTTGGTGCTTGAGCAGGGATAGTTGGTACTGGCCTAAGTCTACTCATCCGAACAGAACTAAGTCAACCAGGATCCCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.38%

Haplotypes4

BIN1

Most divergent pair0.61%

Asia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acroteriobatus zanzibarensissame genus2.1%Acroteriobatus leucospilussame genus4.9%Acroteriobatus blochiisame genus10.5%Acroteriobatus annulatussame genus10.7%Rhinobatos irvineisame family11.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type20 records

Wild obs. + sensor14

Museum / vouchered6

Range

Area of Occupancy AOO64 km²

Depth

0–200 m sunlit1

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 170 m · max 170 m · 1 record with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy43% within 1 km

≤100 m 1≤1 km 2≤10 km 1>10 km 3

7 georeferenced · 7 without coordinates

Open the mapobservation + sensor14

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 6 records without

Open the institutions mapphysical evidence6

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)