Acroteriobatus annulatus

(Müller & Henle, 1841) · species

image placeholder — illustration coming later

Animalia/Chordata/Elasmobranchii/Rhinopristiformes/Rhinobatidae/Acroteriobatus

At a glance

Occurrence records1 153

Data sources9

Biological traits0

DNA specimens47

eDNA detections7

Sources9 archives

Databases and archives Acroteriobatus annulatus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility237 records↗

OBISOcean Biodiversity Information System916 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics47 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF · OBIS1 153 records

Environmental DNA1 datasets · 1 countries7 detections

DNA & barcodingBOLD47 specimens

01Narrative

Acroteriobatus annulatus is een vissensoort uit de familie van de vioolroggen (Rhinobatidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1841 door Müller & Henle.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding47 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acroteriobatus annulatus has left across the world's sequence archives.

At a glance

DNA specimens47

BINs2

Marker genes2

eDNA detections7

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P531 bp consensus28 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 20 variable positions, in barcode order

41Cmostly conserved

68Tmostly conserved

101Gmostly conserved

104Cmostly conserved

116Cmostly conserved

123Cvariable

134Gmostly conserved

164Amostly conserved

218Amostly conserved

236Amostly conserved

239Tmostly conserved

248Gmostly conserved

353Tmostly conserved

383Cmostly conserved

407Cmostly conserved

419Amostly conserved

425Tmostly conserved

440Tmostly conserved

479Amostly conserved

494Tmostly conserved

TTAGTCAACCAGGATCACTCATGGGGGATGACCAGATCTACAATGTCATCGTAACCGCCCATGCCTTTGTAATAATCTTTTTTATGGTTA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.3%

Haplotypes4

BINs2

Most divergent pair3.6%

Africa

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acroteriobatus blochiisame genus3.4%Acroteriobatus leucospilussame genus9.8%Rhinobatos schlegeliisame family10.5%Acroteriobatus variegatussame genus10.7%Rhinobatos formosensissame family11.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PND2

animal barcodemitochondrial

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_068897 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND1ND2COX1COX2ATP8ATP6COX3ND3ND4LND4ND5ND6CYTB12S ribosomal RNA16S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type1 153 records

Wild obs. + sensor1 074

Museum / vouchered78

Other1

Range

Area of Occupancy AOO2 828 km²

Depth

0–200 m sunlit292

200–1000 m twilight2

1–4 km midnight0

>4 km abyssal0

median 73.8 m · max 320 m · 294 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 61≤1 km 85≤10 km 4>10 km 1

151 georeferenced · 923 without coordinates

Open the mapobservation + sensor1 074

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 2≤10 km 2

4 georeferenced · 74 without coordinates

Open the institutions mapphysical evidence78

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
South African Institute for Aquatic Biodiversitylocation not on record	19
FishBaselocation not on record	2
University of Johannesburglocation not on record	2
Stockholm, SE	1

4 institutions · 24 of 78 vouchered records shown · 20 without an institution code

09Environmental DNA7 detections

Where the DNA of Acroteriobatus annulatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.7 °C 15.7–22.0

Seasonal swing summer↔winter5.60 °C

Max temp (day)17.7 °C 16.5–23.7

Min temp (night)15.5 °C 14.8–20.2

Precipitation67.2 mm/mo 39.4–70.9

Air humidity61.3 % 59.1–62.0

Vapour deficit764 Pa 701–1,014

Cloud cover16.7 % 15.7–19.9

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acroteriobatus annulatus

At a glance

Sources9 archives

At a glance

Record type1 153 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions1 of 4 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 153 records