Acroteriobatus blochii

(Müller & Henle, 1841) · species

image placeholder — illustration coming later

Animalia/Chordata/Elasmobranchii/Rhinopristiformes/Rhinobatidae/Acroteriobatus

At a glance

Occurrence records72

Data sources7

Biological traits4

DNA specimens25

eDNA detections2

Sources7 archives

Databases and archives Acroteriobatus blochii's data was compiled from.

GBIFGlobal Biodiversity Information Facility36 records↗

OBISOcean Biodiversity Information System36 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics25 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS72 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD25 specimens

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length100 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonereef-associated

Other traits1

Vulnerability60

05DNA & barcoding25 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acroteriobatus blochii has left across the world's sequence archives.

At a glance

DNA specimens25

BINs1

Marker genes2

eDNA detections2

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P531 bp consensus14 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

35Gmostly conserved

425Cmostly conserved

TTAGTCAACCAGGATCACTCATGGGGGATGACCAGATCTATAATGTCATCGTAACCGCCCATGCCTTCGTAATAATCTTTTTTATGGTTA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.05%

Haplotypes3

BIN1

Most divergent pair0.38%

Africa

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acroteriobatus annulatussame genus3.4%Acroteriobatus leucospilussame genus10.0%Rhinobatos schlegeliisame family10.4%Acroteriobatus variegatussame genus10.5%Rhinobatos irvineisame family10.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PND2

animal barcodemitochondrial

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_068898 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND1ND2COX1COX2ATP8ATP6COX3ND3ND4LND4ND5ND6CYTB12S ribosomal RNA16S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type72 records

Wild obs. + sensor36

Museum / vouchered35

Other1

Range

Area of Occupancy AOO136 km²

Depth

0–200 m sunlit2

200–1000 m twilight1

1–4 km midnight0

>4 km abyssal0

median 15 m · max 915 m · 3 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 11≤1 km 5≤10 km 1>10 km 1

18 georeferenced · 18 without coordinates

Open the mapobservation + sensor36

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy89% within 1 km

≤100 m 8>10 km 1

9 georeferenced · 26 without coordinates

Open the institutions mapphysical evidence35

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
South African Institute for Aquatic Biodiversitylocation not on record	2
FishBaselocation not on record	1

2 institutions · 3 of 35 vouchered records shown · 12 without an institution code

09Environmental DNA2 detections

Where the DNA of Acroteriobatus blochii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)