Acroteriobatus leucospilus

(Norman, 1926) · species

image placeholder — illustration coming later

Animalia/Chordata/Elasmobranchii/Rhinopristiformes/Rhinobatidae/Acroteriobatus

At a glance

Occurrence records72

Data sources9

Biological traits7

DNA specimens15

eDNA detections4

Sources9 archives

Databases and archives Acroteriobatus leucospilus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility20 records↗

OBISOcean Biodiversity Information System52 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources7 traits

Occurrence & distributionGBIF · OBIS72 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD15 specimens

01Narrative

Acroteriobatus leucospilus is een vissensoort uit de familie van de vioolroggen (Rhinobatidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1926 door Norman.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length56.5 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonedemersal

Uses & economy1

Commercial importancesubsistence fisheries

Other traits3

Depth max100 m

Depth min0 m

Vulnerability58.4

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acroteriobatus leucospilus has left across the world's sequence archives.

At a glance

DNA specimens15

BINs1

Marker genes2

eDNA detections4

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P531 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.14%

Haplotypes2

BIN1

Most divergent pair0.56%

Where individuals differ — all 3 variable positions, in barcode order

140Cmostly conserved

155Gmostly conserved

329Amostly conserved

TTAGTCAACCAGGATCCCTTATGGGAGATGACCAAATCTACAATGTTATCGTAACAGCCCATGCCTTTGTAATAATCTTTTTCATGGTTA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acroteriobatus variegatussame genus4.9%Acroteriobatus zanzibarensissame genus6.4%Acroteriobatus annulatussame genus9.8%Acroteriobatus blochiisame genus10.0%Rhinobatos irvineisame family10.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PND2

animal barcodemitochondrial

08Occurrence & distribution

Record type72 records

Wild obs. + sensor42

Museum / vouchered29

Other1

Range

Area of Occupancy AOO128 km²

Depth

0–200 m sunlit5

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 15 m · max 19 m · 5 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 3≤1 km 4≤10 km 2

9 georeferenced · 33 without coordinates

Open the mapobservation + sensor42

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced · 27 without coordinates

Open the institutions mapphysical evidence29

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
South African Institute for Aquatic Biodiversitylocation not on record	4
FishBaselocation not on record	3
University of California San Diegolocation not on record	1

3 institutions · 8 of 29 vouchered records shown · 3 without an institution code

09Environmental DNA4 detections

Where the DNA of Acroteriobatus leucospilus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.8 °C 21.4–24.1

Seasonal swing summer↔winter6.40 °C

Max temp (day)25.1 °C 24.0–26.2

Min temp (night)20.5 °C 18.9–22.0

Precipitation77.5 mm/mo 54.9–100

Air humidity60.9 % 60.3–61.5

Vapour deficit1,082 Pa 1,012–1,152

Cloud cover20.6 % 16.1–25.2

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)