Acronicta lobeliae

Guenée, 1852 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Acronicta

At a glance

Occurrence records1 913

Data sources7

Biological traits0

DNA specimens22

eDNA detections23

Sources7 archives

Databases and archives Acronicta lobeliae's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 913 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI23 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics22 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 913 records

Environmental DNA1 datasets · 2 countries23 detections

DNA & barcodingBOLD22 specimens

01Narrative

Acronicta lobeliae, the lobelia dagger moth or greater oak dagger moth, is a moth of the family Noctuidae. The species was first described by Achille Guenée in 1852. It is found in North America. The larva feed on Quercus species.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding22 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acronicta lobeliae has left across the world's sequence archives.

At a glance

DNA specimens22

BINs1

Marker genes1

eDNA detections23

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus22 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 1 variable positions, in barcode order

202Gvariable

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGTACTTCATTAAGATTACTAATTCGAGCAGAATTAGGAACCCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.17%

Haplotypes8

BIN1

Most divergent pair0.61%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acronicta valliscolasame genus6.5%Acronicta superanssame genus6.8%Acronicta hastasame genus6.8%Acronicta rapidansame genus6.8%Acronicta interruptasame genus7.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 913 records

Wild obs. + sensor1 479

Museum / vouchered434

Range

Area of Occupancy AOO5 900 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 867≤1 km 181≤10 km 98>10 km 111

1 257 georeferenced · 222 without coordinates

Open the mapobservation + sensor1 479

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤100 m 21≤1 km 79≤10 km 176>10 km 23

299 georeferenced · 135 without coordinates

Open the institutions mapphysical evidence434

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 29 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mississippi State, US	99
New Haven, US	84
East Lansing, US	55
Colorado State Universitylocation not on record	47
Georgia Museum of Natural Historylocation not on record	26
CUlocation not on record	19
St. Paul, US	19
Cleveland Museum of Natural History, OH (CLEV)location not on record	14
King Saud Universitylocation not on record	10
ASUlocation not on record	8
OSUClocation not on record	6
Cambridge, US	4
Philadelphia, US	4
UDlocation not on record	4
Cornell University Insect Collectionlocation not on record	3
University of Alberta Museums (UAM)location not on record	3
Chicago, US	2
Washington, US	2
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	2
Decorah, US	2
Denver, US	2
San Francisco, US	1
Royal Saskatchewan Museumlocation not on record	1
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
Tartu, EE	1
Auckland, NZ	1
Universidad Católica de Manizaleslocation not on record	1
Vernal, US	1
Sam Noble Oklahoma Museum of Natural Historylocation not on record	1

29 institutions · 423 of 434 vouchered records shown · 11 without an institution code

09Environmental DNA23 detections

Where the DNA of Acronicta lobeliae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found23

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 23 detections have coordinates

Open the map2 countries0

ForestGrassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.4 °C 10.3–22.2

Seasonal swing summer↔winter24.3 °C

Max temp (day)22.4 °C 15.8–27.2

Min temp (night)12.6 °C 5.50–17.7

Precipitation106 mm/mo 91.8–139

Air humidity59.1 % 54.5–64.3

Moisture balance-14.0 mm/mo -64.3–29.1

Vapour deficit788 Pa 559–1,088

Wind speed3.20 m/s 2.10–5.60

Cloud cover40.5 % 27.6–47.7

CHELSA 1981–2010, ~9 km grid, at location & month of 22 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acronicta lobeliae

At a glance

Sources7 archives

At a glance

Record type1 913 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions14 of 29 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 913 records