Acrobasis vaccinii

Riley, 1884 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Pyralidae/Acrobasis

At a glance

Occurrence records164

Data sources7

Biological traits0

DNA specimens12

eDNA detections11

Sources7 archives

Databases and archives Acrobasis vaccinii's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility164 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF164 records

Environmental DNA1 datasets · 2 countries11 detections

DNA & barcodingBOLD12 specimens

01Narrative

Acrobasis vaccinii, the cranberry fruitworm, is a moth of the family Pyralidae described by Charles Valentine Riley in 1884."Acrobasis Zeller, 1839" at Markku Savela's Lepidoptera and Some Other Life Forms. Retrieved June 15, 2017. It is found in North America from Nova Scotia to Florida and from Wisconsin to Texas, it is introduced in the state of Washington. The wingspan is 16–18 mm. Larvae The larva feed on Vaccinium corymbosum, Vaccinium macrocarpon, Vaccinium vitis-idaea and Vaccinium stamineum. Larvae feed inside a berry until most of its contents have been consumed. Larvae are mostly green, with some brownish-red pigmentation on the dorsal surface, and grow to about half an inch before pupation. Full-grown larvae over winter in a cocoon, and emerge as adults after full bloom and fruit set. Female moths lay their eggs on the fruit, usually on or within the calyx cup of unripe berries.Louisiana State University Agricultural Center Extension website, "Cranberry fruitworm." http://www.lsuagcenter.com/en/crops_livestock/crops/blueberries/pests/CranberryFruitWorm.htm One generation emerges each year,Pennsylvania State Extension website, "Cranberry fruitworm." http://extension.psu.edu/plants/gardening/fphg/blueberries/insect-pests/cranberry-fruitworm with each larvae feeding on as many as eight berries to complete its development.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acrobasis vaccinii has left across the world's sequence archives.

At a glance

DNA specimens12

BINs1

Marker genes1

eDNA detections11

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

34Amostly conserved

61Amostly conserved

133Avariable

181Amostly conserved

316Gmostly conserved

433Avariable

AACTTTATATTTTATTTTTGGAATTTGATCAGGAATAGTTGGTACATCTTTAAGTCTTTTAATTCGAGCTGAATTAGGAACCCCTAAATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.31%

Haplotypes6

BIN1

Most divergent pair0.61%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acrobasis obliquasame genus6.1%Acrobasis centunculellasame genus7.8%Acrobasis ostryellasame genus8.2%Acrobasis caryivorellasame genus8.2%Acrobasis klimeschisame genus8.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type164 records

Wild obs. + sensor45

Museum / vouchered119

Range

Area of Occupancy AOO284 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 15≤1 km 5≤10 km 3

23 georeferenced · 22 without coordinates

Open the mapobservation + sensor45

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy3% within 1 km

≤1 km 3≤10 km 74>10 km 13

90 georeferenced · 29 without coordinates

Open the institutions mapphysical evidence119

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Philadelphia, US	54
New Haven, US	29
Mississippi State, US	15
CUlocation not on record	6
East Lansing, US	4
Georgia Museum of Natural Historylocation not on record	3
Mississippi Entomological Museumlocation not on record	2
Cornell University Insect Collectionlocation not on record	1
Washington, US	1
SOVTlocation not on record	1
Centre for Biodiversity Genomicslocation not on record	1
St. Paul, US	1

12 institutions · 118 of 119 vouchered records shown · 1 without an institution code

09Environmental DNA11 detections

Where the DNA of Acrobasis vaccinii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.2 °C 16.2–24.1

Seasonal swing summer↔winter19.2 °C

Max temp (day)22.1 °C 19.6–25.8

Min temp (night)12.5 °C 11.6–22.7

Precipitation133 mm/mo 113–183

Air humidity58.4 % 56.5–61.8

Moisture balance3.00 mm/mo -29.2–28.9

Vapour deficit851 Pa 728–1,141

Wind speed3.50 m/s 2.60–5.50

Cloud cover39.0 % 34.8–49.1

CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)