Acrobasis repandana

Fabricius, 1798 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Pyralidae/Acrobasis

At a glance

Occurrence records9 498

Data sources8

Biological traits0

DNA specimens51

eDNA detections55

Sources8 archives

Databases and archives Acrobasis repandana's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility9 498 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI55 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics51 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF9 498 records

Environmental DNA3 datasets · 9 countries55 detections

DNA & barcodingBOLD51 specimens

Genome at a glanceGoaT · NCBI≈620 Mbp

01Narrative

De oranje eikenlichtmot is een vlinder uit de familie Pyralidae, de snuitmotten.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding51 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acrobasis repandana has left across the world's sequence archives.

At a glance

DNA specimens51

BINs1

Marker genes1

eDNA detections55

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus49 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 8 variable positions, in barcode order

181Gvariable

217Gvariable

241Amostly conserved

304Cmostly conserved

370Amostly conserved

451Tvariable

565Gmostly conserved

628Gvariable

AACTTTATATTTTATCTTCGGAATTTGAGCTGGAATAGTAGGAACATCTTTAAGACTTTTAATTCGAGCTGAATTAGGAACCCCCGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.51%

Haplotypes17

BIN1

Most divergent pair1.1%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acrobasis tumidanasame genus7.3%Acrobasis marmoreasame genus7.3%Acrobasis ostryellasame genus8.4%Acrobasis suavellasame genus8.4%Acrobasis comptellasame genus8.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Acrobasis repandana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈620 432 220 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Acrobasis repandana0.62 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness99% BUSCO

08Occurrence & distribution

Record type9 498 records

Wild obs. + sensor8 737

Museum / vouchered727

Other34

Origin

Native9

Range

Area of Occupancy AOO10 240 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy36% within 1 km

≤100 m 1 760≤1 km 1 138≤10 km 5 225>10 km 11

8 134 georeferenced · 603 without coordinates

Open the mapobservation + sensor8 737

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy63% within 1 km

≤100 m 249≤1 km 171≤10 km 216>10 km 33

669 georeferenced · 58 without coordinates

Open the institutions mapphysical evidence727

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	254
Helsinki, FI	222
NHMOlocation not on record	46
Provincia di Livornolocation not on record	41
SLU Artdatabankenlocation not on record	27
Nijmegen, NL	24
Tartu, EE	17
Metsähallituslocation not on record	16
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	8
Zürich, CH	5
CBDClocation not on record	4
ZSMlocation not on record	4
NTNU-VMlocation not on record	4
South Kensington, GB	3
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	2
Natural History Museum, Londonlocation not on record	2
BioFokuslocation not on record	1
Rovaniemi, FI	1
Kuopio, FI	1
neflocation not on record	1
Brussels, BE	1

21 institutions · 684 of 727 vouchered records shown · 43 without an institution code

09Environmental DNA55 detections

Where the DNA of Acrobasis repandana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found55

Studies independent surveys3

Countries9

Verifiable raw sequence linked6

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 55 detections have coordinates

Open the map9 countries0

natural woodlandedge forestwoodlandedge woodland/meadow

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.3 °C 14.5–18.5

Seasonal swing summer↔winter17.0 °C

Max temp (day)21.1 °C 18.2–22.7

Min temp (night)13.0 °C 10.5–14.4

Precipitation67.6 mm/mo 45.7–118

Air humidity58.8 % 57.9–61.5

Moisture balance-55.2 mm/mo -86.3–3.10

Vapour deficit805 Pa 646–895

Wind speed3.00 m/s 2.40–4.10

Cloud cover39.5 % 33.8–44.6

CHELSA 1981–2010, ~9 km grid, at location & month of 52 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acrobasis repandana

At a glance

Sources8 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type9 498 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 21 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type9 498 records