Acrobasis comptella

Ragonot, 1887 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Pyralidae/Acrobasis

At a glance

Occurrence records51

Data sources7

Biological traits0

DNA specimens13

eDNA detections17

Sources7 archives

Databases and archives Acrobasis comptella's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility51 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI17 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF51 records

Environmental DNA1 datasets · 1 countries17 detections

DNA & barcodingBOLD13 specimens

01Narrative

Acrobasis comptella is a species of snout moth in the genus Acrobasis. It was described by Émile Louis Ragonot in 1887, and is known from the western United States. The larvae feed on Quercus dumosa, Quercus douglasii, Quercus garryana, Quercus ajoensis and Chrysolepis sempervirens.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acrobasis comptella has left across the world's sequence archives.

At a glance

DNA specimens13

BINs2

Marker genes1

eDNA detections17

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 31 variable positions, in barcode order

2Amostly conserved

3Cmostly conserved

38Avariable

40Avariable

67Amostly conserved

85Cvariable

106Tmostly conserved

127Cvariable

130Cmostly conserved

131Avariable

187Tmostly conserved

205Avariable

220Tmostly conserved

235Cmostly conserved

277Tmostly conserved

283Tmostly conserved

391Tvariable

406Cmostly conserved

450Cmostly conserved

499Tmostly conserved

542Cvariable

562Amostly conserved

565Amostly conserved

566Gmostly conserved

578Cmostly conserved

610Cmostly conserved

616Cmostly conserved

625Amostly conserved

628Tmostly conserved

637Tmostly conserved

652Cmostly conserved

AACTTTATATTTTATTTTTGGAATTTGATCAGGAATAATAGGAACATCTTTAAGTTTATTAATTCGAGCTGAATTAGGAACTCCCGGCTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.7%

Haplotypes5

BINs2

Most divergent pair4.1%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acrobasis blanchardorumsame genus4.7%Acrobasis minimellasame genus4.9%Acrobasis caliginellasame genus5.4%Acrobasis ostryellasame genus6.8%Acrobasis carpinivorellasame genus7.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type51 records

Wild obs. + sensor30

Museum / vouchered21

Range

Area of Occupancy AOO124 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 11≤1 km 7≤10 km 4

22 georeferenced · 8 without coordinates

Open the mapobservation + sensor30

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 4>10 km 1

5 georeferenced · 16 without coordinates

Open the institutions mapphysical evidence21

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	12
Mississippi State, US	3
New Haven, US	2
East Lansing, US	2
Smithsonian Institution, National Museum of Natural Historylocation not on record	1
Georgia Museum of Natural Historylocation not on record	1

6 institutions · 21 of 21 vouchered records shown

09Environmental DNA17 detections

Where the DNA of Acrobasis comptella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found17

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 17 detections have coordinates

Open the map1 country0

MarshPines

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.5 °C 17.4–23.7

Seasonal swing summer↔winter16.0 °C

Max temp (day)24.6 °C 21.2–31.4

Min temp (night)15.7 °C 11.8–18.2

Precipitation12.3 mm/mo 1.80–55.6

Air humidity57.3 % 38.7–67.8

Moisture balance-150 mm/mo -183–-116

Vapour deficit950 Pa 729–1,618

Wind speed3.00 m/s 2.10–3.20

Cloud cover20.7 % 13.7–29.1

CHELSA 1981–2010, ~9 km grid, at location & month of 14 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)