Acrobasis porphyrella

Duponchel, 1836 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Pyralidae/Acrobasis

At a glance

Occurrence records420

Data sources6

Biological traits0

DNA specimens9

eDNA detections0

Sources6 archives

Databases and archives Acrobasis porphyrella's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility420 records↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF420 records

DNA & barcodingBOLD9 specimens

01Narrative

Acrobasis porphyrella is a moth of the family Pyralidae. It is known from Spain, Portugal, France, Corsica, Sardinia, the Balearic Islands, Italy and Croatia. The larvae feed on Erica arborea and Erica scoparia.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acrobasis porphyrella has left across the world's sequence archives.

At a glance

DNA specimens9

BINs1

Marker genes1

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.10%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 3 variable positions, in barcode order

269Tmostly conserved

366Gmostly conserved

378Gmostly conserved

CTTTATATTTTATTTTTGGAATTTGATCAGGAATAGTAGGAACATCTATAAGATTATTAATTCGAGCTGAATTAGGTACTCCAGGATCTT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acrobasis aurorellasame genus6.9%Acrobasis demotellasame genus6.9%Acrobasis ostryellasame genus7.0%Acrobasis stigmellasame genus7.0%Acrobasis caryivorellasame genus7.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type420 records

Wild obs. + sensor410

Museum / vouchered10

Origin

Native1

Range

Area of Occupancy AOO952 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy70% within 1 km

≤100 m 131≤1 km 77≤10 km 78>10 km 10

296 georeferenced · 114 without coordinates

Open the mapobservation + sensor410

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy71% within 1 km

≤100 m 5≤10 km 2

7 georeferenced · 3 without coordinates

Open the institutions mapphysical evidence10

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DABUHlocation not on record	5
Tartu, EE	1

2 institutions · 6 of 10 vouchered records shown · 4 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)