Acleris semiannula

(Robinson, 1869) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Acleris

At a glance

Occurrence records393

Data sources8

Biological traits0

DNA specimens135

eDNA detections155

Sources8 archives

Databases and archives Acleris semiannula's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility393 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI155 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics135 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF393 records

Environmental DNA1 datasets · 2 countries155 detections

DNA & barcodingBOLD135 specimens

01Narrative

Acleris semiannula is a species of moth of the family Tortricidae. It is found in North America, where it has been recorded from Alberta, British Columbia, Illinois, Maine, Maryland, Mississippi, New Brunswick, New York, Ohio, Ontario, Pennsylvania, Quebec, South Carolina, West Virginia and Wisconsin.mothphotographersgroup The wingspan is 12–15 mm. The forewings are usually light red-brown, but may also be pale to fawn and sometimes even dull smoky grey. The costal triangle is often composed of red-brown scales, but may also be dark brown.McDunnough, J. 1934. The Canadian species of the Tortricid genus Peronea. Canadian Journal of Research, 1934, 11(3): 290-332 Adults have been recorded on wing year round. The larvae feed on Acer rubrum, Acer saccharinum and Quercus alba.Tortricidae Food Plant Database

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding135 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acleris semiannula has left across the world's sequence archives.

At a glance

DNA specimens135

BINs2

Marker genes1

eDNA detections155

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus123 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 28 variable positions, in barcode order

7Gmostly conserved

40Amostly conserved

68Gmostly conserved

85Cmostly conserved

115Cmostly conserved

163Gmostly conserved

166Amostly conserved

202Tmostly conserved

205Cmostly conserved

211Gmostly conserved

226Cmostly conserved

292Tmostly conserved

304Cmostly conserved

337Cmostly conserved

364Tmostly conserved

394Tmostly conserved

406Tmostly conserved

460Cmostly conserved

490Cmostly conserved

505Cmostly conserved

508Cmostly conserved

511Amostly conserved

514Cmostly conserved

517Amostly conserved

562Tmostly conserved

574Cmostly conserved

583Amostly conserved

616Tvariable

AACATTGTATTTTATTTTTGGAATTTGAGCAGGTATAGTAGGAACTTCTTTAAGATTATTAATTCGAGCAGAATTAGGAAATCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.2%

Haplotypes15

BINs2

Most divergent pair4.6%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acleris ferrumixtanasame genus3.3%Acleris subnivanasame genus3.5%Acleris kearfottanasame genus3.6%Acleris forbesanasame genus3.8%Acleris cervinanasame genus4.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type393 records

Wild obs. + sensor26

Museum / vouchered367

Range

Area of Occupancy AOO328 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 15≤1 km 4

19 georeferenced · 7 without coordinates

Open the mapobservation + sensor26

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy37% within 1 km

≤100 m 3≤1 km 65≤10 km 114>10 km 3

185 georeferenced · 182 without coordinates

Open the institutions mapphysical evidence367

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	144
University of Guelph, Centre for Biodiversity Genomicslocation not on record	60
East Lansing, US	38
University of Alberta Museums (UAM)location not on record	14
St. Paul, US	10
Cornell University Insect Collectionlocation not on record	7
Edmonton, CA	2
CUlocation not on record	1
Mississippi State, US	1
Research Collection of Daniel Handfieldlocation not on record	1
SOVTlocation not on record	1

11 institutions · 279 of 367 vouchered records shown · 88 without an institution code

09Environmental DNA155 detections

Where the DNA of Acleris semiannula was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found155

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 155 detections have coordinates

Open the map2 countries0

1. Forest & Woodland|1.1 Boreal ForestForest1. Forest & Woodland|1.1. Boreal ForestTemperate mixed forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.5 °C 4.60–20.4

Seasonal swing summer↔winter26.1 °C

Max temp (day)18.8 °C 8.70–25.7

Min temp (night)9.90 °C 1.80–16.0

Precipitation86.9 mm/mo 74.8–113

Air humidity59.0 % 54.8–61.2

Moisture balance-11.0 mm/mo -59.1–60.1

Vapour deficit670 Pa 326–1,016

Wind speed3.30 m/s 2.50–4.10

Cloud cover47.9 % 39.0–58.2

CHELSA 1981–2010, ~9 km grid, at location & month of 155 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)