Acleris oxycoccana

(Packard, 1869) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Acleris

At a glance

Occurrence records272

Data sources8

Biological traits0

DNA specimens26

eDNA detections34

Sources8 archives

Databases and archives Acleris oxycoccana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility272 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI34 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics26 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF272 records

Environmental DNA1 datasets · 1 countries34 detections

DNA & barcodingBOLD26 specimens

01Narrative

Acleris oxycoccana is a species of moth of the family Tortricidae. It is found in North America, where it has been recorded from Alberta, British Columbia, Indiana, Maine, Manitoba, Michigan, Minnesota, Newfoundland, Ontario, Pennsylvania, West Virginia and Wisconsin.mothphotographersgroup The wingspan is 13–15 mm. The colouration of the forewings is quite variable, ranging from uniform deep black-brown with scattered ruddy scaling to bright red-brown.McDunnough, J. 1934. The Canadian species of the Tortricid genus Peronea. Canadian Journal of Research, 1934, 11(3): 290-332 Adults have been recorded on wing nearly year round. The larvae feed on Chamaedaphne calyculata and Prunus pumila.Tortricidae Food Plant Database

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding26 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acleris oxycoccana has left across the world's sequence archives.

At a glance

DNA specimens26

BINs1

Marker genes1

eDNA detections34

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus22 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

160Amostly conserved

481Amostly conserved

562Gvariable

577Avariable

578Cmostly conserved

646Tmostly conserved

AACAATATATTTTATTTTTGGTATTTGAGCAGGAATAGTTGGAACTTCTTTAAGACTATTAATTCGAGCAGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.34%

Haplotypes8

BIN1

Most divergent pair0.46%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acleris schallerianasame genus4.0%Acleris maximanasame genus4.9%Acleris hyemanasame genus5.2%Acleris varieganasame genus5.3%Acleris maculidorsanasame genus5.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type272 records

Wild obs. + sensor153

Museum / vouchered119

Range

Area of Occupancy AOO532 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 75≤1 km 34≤10 km 18>10 km 11

138 georeferenced · 15 without coordinates

Open the mapobservation + sensor153

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy80% within 1 km

≤1 km 16≤10 km 4

20 georeferenced · 99 without coordinates

Open the institutions mapphysical evidence119

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
St. Paul, US	56
University of Alberta Museums (UAM)location not on record	34
East Lansing, US	18
Research Collection of Daniel Handfieldlocation not on record	5
University of Guelph, Centre for Biodiversity Genomicslocation not on record	3
New Haven, US	2

6 institutions · 118 of 119 vouchered records shown · 1 without an institution code

09Environmental DNA34 detections

Where the DNA of Acleris oxycoccana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found34

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 34 detections have coordinates

Open the map1 country0

18:00h, in flight, 7°C

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median7.30 °C 6.50–13.5

Seasonal swing summer↔winter29.0 °C

Max temp (day)11.5 °C 9.80–19.5

Min temp (night)5.20 °C 3.10–11.2

Precipitation95.4 mm/mo 53.8–119

Air humidity59.8 % 56.7–60.8

Moisture balance13.7 mm/mo

Vapour deficit423 Pa 386–656

Wind speed3.30 m/s

Cloud cover53.1 % 46.9–68.0

CHELSA 1981–2010, ~9 km grid, at location & month of 30 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)