Acleris macdunnoughi

Obraztsov, 1963 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Acleris

At a glance

Occurrence records636

Data sources8

Biological traits0

DNA specimens61

eDNA detections62

Sources8 archives

Databases and archives Acleris macdunnoughi's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility636 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI62 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics61 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF636 records

Environmental DNA1 datasets · 2 countries62 detections

DNA & barcodingBOLD61 specimens

01Narrative

Acleris macdunnoughi is a species of moth of the family Tortricidae. It is found in North America, where it has been recorded from Alberta, Kentucky, Maine, Massachusetts, Michigan, Minnesota, Montana, New Brunswick, North Carolina, Ohio, Ontario, Pennsylvania, Quebec, Tennessee, Vermont, Washington and West Virginia.mothphotographersgroup The length of the forewings is 8–9 mm. The forewings are whitish brown-grey with fine dark brown striation. The hindwings are smoky brownish.Obraztsov, 1963. Some North American moths of the genus Acleris (Lepidoptera: Tortricidae). Proceedings of the United States National Museum. 114: 214 Adults have been recorded on wing from April to October. The larvae feed on Rubus species and Spiraea latifolia.Bug Guide

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding61 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acleris macdunnoughi has left across the world's sequence archives.

At a glance

DNA specimens61

BINs1

Marker genes1

eDNA detections62

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus60 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 11 variable positions, in barcode order

40Cvariable

52Gmostly conserved

205Tmostly conserved

232Cmostly conserved

312Amostly conserved

364Tmostly conserved

478Tvariable

511Gvariable

607Amostly conserved

625Amostly conserved

628Gmostly conserved

AACATTATATTTTATTTTTGGTATTTGAGCAGGTATAGTCGGAACTTCTTTGAGACTATTAATTCGAGCTGAATTAGGAAACCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.62%

Haplotypes10

BIN1

Most divergent pair1.8%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acleris undulanasame genus6.1%Acleris maximanasame genus6.5%Acleris comarianasame genus6.7%Acleris subnivanasame genus6.7%Acleris kochiellasame genus6.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type636 records

Wild obs. + sensor555

Museum / vouchered81

Range

Area of Occupancy AOO952 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 357≤1 km 54≤10 km 12>10 km 37

460 georeferenced · 95 without coordinates

Open the mapobservation + sensor555

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 1≤1 km 1≤10 km 2

4 georeferenced · 77 without coordinates

Open the institutions mapphysical evidence81

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cornell University Insect Collectionlocation not on record	26
University of Alberta Museums (UAM)location not on record	20
University of Guelph, Centre for Biodiversity Genomicslocation not on record	10
St. Paul, US	4
Cambridge, US	2
Research Collection of Daniel Handfieldlocation not on record	1
East Lansing, US	1
Colorado State Universitylocation not on record	1
Washington, US	1

9 institutions · 66 of 81 vouchered records shown · 15 without an institution code

09Environmental DNA62 detections

Where the DNA of Acleris macdunnoughi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found62

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 62 detections have coordinates

Open the map2 countries0

ForestTemperate mixed forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.2 °C 7.70–18.1

Seasonal swing summer↔winter30.0 °C

Max temp (day)17.2 °C 12.2–22.6

Min temp (night)10.4 °C 4.50–14.6

Precipitation111 mm/mo 85.5–114

Air humidity60.3 % 59.7–61.9

Moisture balance32.1 mm/mo -23.6–67.5

Vapour deficit597 Pa 418–799

Wind speed2.90 m/s 2.30–3.40

Cloud cover55.3 % 39.8–65.9

CHELSA 1981–2010, ~9 km grid, at location & month of 60 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)