Acleris maccana

(Treitschke, 1835) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Acleris

At a glance

Occurrence records4 786

Data sources10

Biological traits2

DNA specimens146

eDNA detections335

Sources10 archives

Databases and archives Acleris maccana's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 786 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI335 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics146 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF4 786 records

Environmental DNA3 datasets · 8 countries335 detections

DNA & barcodingBOLD146 specimens

Genome at a glanceGoaT · NCBI≈643 Mbp

01Narrative

Acleris maccana, the marbled dog's-tooth tortrix, is a moth of the family Tortricidae. The species was first described by Georg Friedrich Treitschke in 1835. It is found from Europe, east across the boreal regions to Siberia. In North America it occurs across much of the boreal forest region, south in the mountains in the east. The wingspan is 19–25 mm. Adults are on wing in late fall and again in early spring. There is one generation per year. The larvae feed on deciduous trees and shrubs, including Myrica (including Myrica gale), Vaccinium (including Vaccinium myrtillus and Vaccinium uliginosum), Rhododendron, Malus, Betula, Salix and Populus species. They live between leaves spun together with silk.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding146 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acleris maccana has left across the world's sequence archives.

At a glance

DNA specimens146

BINs1

Marker genes1

eDNA detections335

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus137 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

175Amostly conserved

181Avariable

508Avariable

553Avariable

604Gvariable

625Gvariable

AACATTATATTTTATTTTTGGAATTTGAGCAGGTATAGTAGGAACTTCTTTAAGATTATTAATTCGAGCAGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.60%

Haplotypes12

BIN1

Most divergent pair1.4%

N.AmericaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acleris hyemanasame genus4.9%Acleris kochiellasame genus5.6%Acleris lipsianasame genus5.9%Acleris sparsanasame genus5.9%Acleris aenigmanasame genus5.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Acleris maccana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈642 904 410 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Acleris maccana0.64 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness99.5% BUSCO

08Occurrence & distribution

Record type4 786 records

Wild obs. + sensor3 741

Museum / vouchered1 037

Other8

Range

Area of Occupancy AOO5 156 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 2 217≤1 km 752≤10 km 574>10 km 27

3 570 georeferenced · 171 without coordinates

Open the mapobservation + sensor3 741

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy88% within 1 km

≤100 m 326≤1 km 275≤10 km 82>10 km 1

684 georeferenced · 353 without coordinates

Open the institutions mapphysical evidence1 037

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 35 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NHMOlocation not on record	111
University of Alberta Museums (UAM)location not on record	105
Kuopio, FI	75
DanishLepidopterologicalSocietylocation not on record	73
Garðabær, IS	60
Tartu, EE	57
Edmonton, CA	42
University of Guelph, Centre for Biodiversity Genomicslocation not on record	34
Rovaniemi, FI	25
NTNU-VMlocation not on record	23
SLU Artdatabankenlocation not on record	19
Metsähallituslocation not on record	17
Stockholm, SE	11
New Haven, US	10
RMZlocation not on record	9
Provincia di Livornolocation not on record	7
BioFokuslocation not on record	7
University of Oulu, Zoological Museumlocation not on record	6
ZMAAlocation not on record	6
St. Paul, US	6
Tallinn, EE	3
San Francisco, US	3
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	3
NMBU:MINAlocation not on record	2
SOVTlocation not on record	2
ZSMlocation not on record	1
Salzburg, AT	1
Washington, US	1
Cambridge, US	1
Royal Saskatchewan Museumlocation not on record	1
Cornell University Insect Collectionlocation not on record	1
Research Collection of Daniel Handfieldlocation not on record	1
Research Collection of Kai Berggrenlocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1
neflocation not on record	1

35 institutions · 726 of 1 037 vouchered records shown · 311 without an institution code

09Environmental DNA335 detections

Where the DNA of Acleris maccana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found335

Studies independent surveys3

Countries8

Verifiable raw sequence linked187

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 335 detections have coordinates

Open the map8 countries0

Mixed habitatForestHay meadowUrban1. Forest & Woodland1. Forest & Woodland | 1.1 Boreal Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median8.10 °C 4.40–13.8

Seasonal swing summer↔winter25.4 °C

Max temp (day)11.6 °C 7.00–17.8

Min temp (night)4.40 °C -0.3–10.1

Precipitation75.1 mm/mo 43.9–111

Air humidity59.9 % 55.3–65.1

Moisture balance9.90 mm/mo -42.9–50.1

Vapour deficit440 Pa 315–676

Wind speed2.60 m/s 1.90–3.70

Cloud cover51.8 % 42.7–59.7

CHELSA 1981–2010, ~9 km grid, at location & month of 330 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acleris maccana

At a glance

Sources10 archives

Diet & foraging2

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type4 786 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions13 of 35 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 786 records