Acleris flavivittana

(Clemens, 1864) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Acleris

At a glance

Occurrence records399

Data sources8

Biological traits0

DNA specimens44

eDNA detections41

Sources8 archives

Databases and archives Acleris flavivittana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility399 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI41 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics44 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF399 records

Environmental DNA1 datasets · 2 countries41 detections

DNA & barcodingBOLD44 specimens

01Narrative

Acleris flavivittana, the multiform leafroller moth, is a species of moth of the family Tortricidae. It is found in North America, where it has been recorded from Georgia, Illinois, Indiana, Kentucky, Maine, Maryland, Massachusetts, Michigan, New Brunswick, New Hampshire, New Jersey, New York, North Carolina, Ohio, Ontario, Pennsylvania, Quebec, Tennessee, Vermont, Virginia, Washington, West Virginia and Wisconsin.mothphotographersgroup The wingspan is 18–19 mm. Adults are variable in color, but most have blackish-brown forewings with light brown spotting along the costa and outer margin and strong scale-tufting. Paler specimens have a deep blackish basal area and other specimens are more evenly purple brown with pale streaking along the inner margin.McDunnough, J. 1934. The Canadian species of the Tortricid genus Peronea. Canadian Journal of Research, 1934, 11(3): 290–332 Adults have been recorded on wing year round. The larvae feed on Malus pumila and Prunus pensylvanica.Tortricidae Food Plant Database

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding44 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acleris flavivittana has left across the world's sequence archives.

At a glance

DNA specimens44

BINs2

Marker genes1

eDNA detections41

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus40 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

115Tmostly conserved

133Tmostly conserved

151Cvariable

313Cvariable

421Avariable

508Gmostly conserved

AACATTATATTTTATTTTTGGTATTTGAGCAGGTATAGTAGGAACTTCTTTAAGATTATTAATTCGAGCAGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.0%

Haplotypes11

BINs2

Most divergent pair1.5%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acleris hippophaeanasame genus4.6%Acleris varieganasame genus4.7%Acleris younganasame genus5.0%Acleris robinsonianasame genus5.1%Acleris kochiellasame genus5.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type399 records

Wild obs. + sensor270

Museum / vouchered129

Range

Area of Occupancy AOO780 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 174≤1 km 27≤10 km 14>10 km 13

228 georeferenced · 42 without coordinates

Open the mapobservation + sensor270

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy29% within 1 km

≤1 km 6≤10 km 12>10 km 3

21 georeferenced · 108 without coordinates

Open the institutions mapphysical evidence129

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
St. Paul, US	75
New Haven, US	12
East Lansing, US	9
University of Guelph, Centre for Biodiversity Genomicslocation not on record	8
Research Collection of Daniel Handfieldlocation not on record	4
Cornell University Insect Collectionlocation not on record	3
University of Alberta Museums (UAM)location not on record	1
Centre for Biodiversity Genomicslocation not on record	1

8 institutions · 113 of 129 vouchered records shown · 16 without an institution code

09Environmental DNA41 detections

Where the DNA of Acleris flavivittana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found41

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 41 detections have coordinates

Open the map2 countries0

GrasslandTemperate mixed forestMixte - Champs

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.50 °C 5.40–23.7

Seasonal swing summer↔winter26.2 °C

Max temp (day)15.2 °C 10.0–29.0

Min temp (night)4.10 °C 0.6–18.7

Precipitation84.2 mm/mo 75.0–113

Air humidity57.3 % 54.8–60.8

Moisture balance-18.3 mm/mo -61.9–22.8

Vapour deficit539 Pa 396–1,194

Wind speed3.40 m/s 2.50–4.30

Cloud cover47.2 % 33.1–55.5

CHELSA 1981–2010, ~9 km grid, at location & month of 39 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)