Acleris robinsoniana

(Forbes, 1923) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Acleris

At a glance

Occurrence records266

Data sources8

Biological traits0

DNA specimens28

eDNA detections24

Sources8 archives

Databases and archives Acleris robinsoniana's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility266 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI24 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics28 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF266 records

Environmental DNA1 datasets · 2 countries24 detections

DNA & barcodingBOLD28 specimens

01Narrative

Acleris robinsoniana, Robinson's acleris moth, is a species of moth of the family Tortricidae. It is found in North America, where it has been recorded from the north-eastern United States across southern Canada to British Columbia and south to California.mothphotographersgroup The length of the forewings is 8.1–8.7 mm. Adults have a variable forewing pattern, ranging from uniform brown, to specimens with a white basal area and brown outer area or even specimens with a dark blue-grey ground colour with a yellow dorsal margin. There are up to two generations per year with adults on wing from May to June. The larvae feed on Rosa californica. Young larvae fold or tie developing leaves and feed on the upper surface. Older larvae fold leaves and feed on the apical half. The species overwinters as an adult.LBAM Illustrated Fact Sheet

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding28 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acleris robinsoniana has left across the world's sequence archives.

At a glance

DNA specimens28

BINs4

Marker genes1

eDNA detections24

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P632 bp consensus26 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 92% of positions are identical in every specimen.

Where individuals differ — all 52 variable positions, in barcode order

34Tvariable

40Avariable

70Amostly conserved

97Tmostly conserved

139Tmostly conserved

160Avariable

163Amostly conserved

202Avariable

214Amostly conserved

220Cmostly conserved

238Tvariable

253Amostly conserved

266Cmostly conserved

268Amostly conserved

271Cmostly conserved

274Cmostly conserved

284Cmostly conserved

286Cmostly conserved

287Cmostly conserved

289Cvariable

298Tvariable

313Cmostly conserved

334Amostly conserved

346Amostly conserved

352Tmostly conserved

355Cmostly conserved

364Tvariable

370Avariable

379Tmostly conserved

394Tmostly conserved

400Cmostly conserved

401Cmostly conserved

403Tmostly conserved

412Tmostly conserved

415Avariable

442Cvariable

445Cmostly conserved

460Cmostly conserved

469Amostly conserved

472Cvariable

485Tmostly conserved

499Tmostly conserved

508Amostly conserved

514Tmostly conserved

553Amostly conserved

562Avariable

574Cvariable

577Gvariable

604Tvariable

610Cmostly conserved

625Amostly conserved

631Amostly conserved

AACATTATATTTTATTTTTGGTATTTGAGCAGGTATAGTAGGAACTTCTTTAAGATTATTAATTCGAGCAGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.3%

Haplotypes12

BINs4

Most divergent pair7.1%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acleris younganasame genus4.0%Acleris hippophaeanasame genus4.7%Acleris arcticanasame genus4.7%Acleris flavivittanasame genus5.1%Acleris hastianasame genus5.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type266 records

Wild obs. + sensor204

Museum / vouchered62

Range

Area of Occupancy AOO644 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 125≤1 km 24≤10 km 5>10 km 20

174 georeferenced · 30 without coordinates

Open the mapobservation + sensor204

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 2≤1 km 1>10 km 3

6 georeferenced · 56 without coordinates

Open the institutions mapphysical evidence62

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Alberta Museums (UAM)location not on record	28
University of Guelph, Centre for Biodiversity Genomicslocation not on record	7
East Lansing, US	3
St. Paul, US	3
Mississippi State, US	2
New Haven, US	2
Royal Saskatchewan Museumlocation not on record	2
Colorado State Universitylocation not on record	2
San Francisco, US	1
Research Collection of Daniel Handfieldlocation not on record	1
Washington State Department of Agriculturelocation not on record	1

11 institutions · 52 of 62 vouchered records shown · 10 without an institution code

09Environmental DNA24 detections

Where the DNA of Acleris robinsoniana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found24

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 24 detections have coordinates

Open the map2 countries0

3. Shrubland|3.4. Temperate ShrublandForest1. Forest & Woodland | 1.4. Temperate Forest1. Forest & Woodland|1.1. Boreal Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median8.70 °C 4.10–20.8

Seasonal swing summer↔winter27.0 °C

Max temp (day)13.7 °C 7.20–25.1

Min temp (night)4.30 °C -1.10–18.4

Precipitation73.0 mm/mo 27.7–105

Air humidity57.6 % 52.3–61.9

Moisture balance-46.3 mm/mo -95.9–29.7

Vapour deficit473 Pa 331–1,093

Wind speed2.90 m/s 2.00–5.20

Cloud cover43.9 % 35.3–53.3

CHELSA 1981–2010, ~9 km grid, at location & month of 24 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)