Acleris arcticana

(Guenée, 1845) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Acleris

At a glance

Occurrence records66

Data sources8

Biological traits0

DNA specimens17

eDNA detections13

Sources8 archives

Databases and archives Acleris arcticana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility66 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics17 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF66 records

Environmental DNA1 datasets · 3 countries13 detections

DNA & barcodingBOLD17 specimens

01Narrative

Acleris arcticana is a species of moth of the family Tortricidae. It is found in Norway, Sweden, Finland,Fauna Europaea Greenland and North America, where it has been recorded from Ontario, Illinois and Wisconsin.mothphotographersgroup The wingspan is 14–24 mm. The forewings are very dark smoky grey with a faint oblique antemedian band, represented by a few dark scales near the costa. There are some scattered blackish scales in the apical portion. The hindwings are pale smoky, slightly speckled with black near the apex.McDunnough, J. 1934. The Canadian species of the Tortricid genus Peronea. Canadian Journal of Research, 1934, 11(3): 290-332 Adults are on wing from April to June and from August to September. The larvae feed on Salix glauca.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding17 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acleris arcticana has left across the world's sequence archives.

At a glance

DNA specimens17

BINs3

Marker genes1

eDNA detections13

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus15 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 34 variable positions, in barcode order

23Amostly conserved

37Amostly conserved

40Amostly conserved

64Cvariable

67Amostly conserved

88Gvariable

100Tmostly conserved

115Tmostly conserved

118Tmostly conserved

145Tmostly conserved

160Gmostly conserved

166Amostly conserved

181Tmostly conserved

202Avariable

217Amostly conserved

235Cmostly conserved

266Cmostly conserved

271Cmostly conserved

286Tvariable

287Tmostly conserved

307Amostly conserved

364Tmostly conserved

370Cmostly conserved

401Tvariable

433Amostly conserved

520Amostly conserved

553Amostly conserved

565Avariable

583Amostly conserved

616Cmostly conserved

622Tmostly conserved

628Avariable

631Avariable

646Cmostly conserved

AACATTATATTTTATTTTTGGTATTTGAGCAGGTATAGTAGGAACTTCTTTAAGATTATTAATCCGAGCAGAATTAGGAAATCCTGGGTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.4%

Haplotypes9

BINs3

Most divergent pair3.3%

N.AmericaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acleris hippophaeanasame genus2.9%Acleris hastianasame genus3.2%Acleris younganasame genus3.5%Acleris robinsonianasame genus4.7%Acleris cristanasame genus5.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type66 records

Wild obs. + sensor14

Museum / vouchered52

Range

Area of Occupancy AOO128 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 6≤1 km 5>10 km 2

13 georeferenced · 1 without coordinates

Open the mapobservation + sensor14

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy92% within 1 km

≤100 m 10≤1 km 23≤10 km 2>10 km 1

36 georeferenced · 16 without coordinates

Open the institutions mapphysical evidence52

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Edmonton, CA	27
NHMOlocation not on record	8
St. Paul, US	7
Copenhagen, DK	3
East Lansing, US	2
University of Copenhagenlocation not on record	1
DOI/FWS, Kenai National Wildlife Refugelocation not on record	1
Research Collection of Daniel Handfieldlocation not on record	1

8 institutions · 50 of 52 vouchered records shown · 2 without an institution code

09Environmental DNA13 detections

Where the DNA of Acleris arcticana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found13

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 13 detections have coordinates

Open the map3 countries0

Wetland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median5.00 °C 0.9–7.20

Seasonal swing summer↔winter26.8 °C

Max temp (day)7.20 °C 5.60–10.9

Min temp (night)1.80 °C -4.10–2.40

Precipitation75.9 mm/mo 43.8–122

Air humidity60.9 % 56.5–62.9

Moisture balance4.90 mm/mo -21.3–25.5

Vapour deficit359 Pa 283–378

Wind speed3.90 m/s 1.80–8.50

Cloud cover51.7 % 36.1–61.9

CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)