Acidia cognata

(Wiedemann, 1817) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Tephritidae/Acidia

At a glance

Occurrence records1 727

Data sources9

Biological traits2

DNA specimens21

eDNA detections44

Sources9 archives

Databases and archives Acidia cognata's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 727 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI44 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics21 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF1 727 records

Environmental DNA3 datasets · 8 countries44 detections

DNA & barcodingBOLD21 specimens

Genome at a glanceGoaT · NCBI≈920 Mbp

01Narrative

Acidia cognata is a species of fly in the family Tephritidae.BioLib

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding21 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acidia cognata has left across the world's sequence archives.

At a glance

DNA specimens21

BINs1

Marker genes1

eDNA detections44

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus21 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

10Cmostly conserved

286Gmostly conserved

409Amostly conserved

634Cmostly conserved

AACTTTATACTTTATTTTCGGAGCATGAGCTGGAATAGTAGGAACATCACTTAGTATTTTAATTCGAGCTGAACTAGGTCATCCAGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.18%

Haplotypes5

BIN1

Most divergent pair0.61%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Trypeta flaveolasame family8.4%Trypeta immaculatasame family8.9%Trypeta zoesame family9.1%Botanophila relativasame order11.2%Opacifrons bisectasame order11.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Acidia cognata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈920 115 460 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Acidia cognata0.92 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness99.1% BUSCO

08Occurrence & distribution

Record type1 727 records

Wild obs. + sensor1 224

Museum / vouchered503

Range

Area of Occupancy AOO4 244 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy63% within 1 km

≤100 m 467≤1 km 223≤10 km 404>10 km 3

1 097 georeferenced · 127 without coordinates

Open the mapobservation + sensor1 224

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy81% within 1 km

≤100 m 310≤1 km 72≤10 km 91

473 georeferenced · 30 without coordinates

Open the institutions mapphysical evidence503

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
MZLUlocation not on record	73
Helsinki, FI	44
SLU Artdatabankenlocation not on record	23
Natural History Museum Rotterdamlocation not on record	10
DFFW2018location not on record	8
University of Tokyo, Department of Zoologylocation not on record	8
Stockholm, SE	8
NCMGlocation not on record	8
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	8
BioFokuslocation not on record	5
CBDClocation not on record	4
ZMAAlocation not on record	4
Gothenburg, SE	3
South Kensington, GB	3
Metsähallituslocation not on record	2
neflocation not on record	2
Tromsø, NO	1
NTNU-VMlocation not on record	1

18 institutions · 215 of 503 vouchered records shown · 288 without an institution code

09Environmental DNA44 detections

Where the DNA of Acidia cognata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found44

Studies independent surveys3

Countries8

Verifiable raw sequence linked25

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 44 detections have coordinates

Open the map8 countries0

1. Forest & Woodland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.6 °C 11.7–15.7

Seasonal swing summer↔winter22.5 °C

Max temp (day)17.5 °C 14.5–19.1

Min temp (night)10.1 °C 7.80–11.7

Precipitation101 mm/mo 67.2–147

Air humidity61.4 % 56.7–64.2

Moisture balance17.4 mm/mo -42.7–166

Vapour deficit602 Pa 439–689

Wind speed2.70 m/s 2.30–5.80

Cloud cover48.6 % 38.5–53.7

CHELSA 1981–2010, ~9 km grid, at location & month of 44 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acidia cognata

At a glance

Sources9 archives

Diet & foraging2

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type1 727 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions5 of 18 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 727 records