Achyra coelatalis

Walker, 1859 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Crambidae/Achyra

At a glance

Occurrence records497

Data sources7

Biological traits0

DNA specimens38

eDNA detections60

Sources7 archives

Databases and archives Achyra coelatalis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility497 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI60 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics38 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF497 records

Environmental DNA1 datasets · 9 countries60 detections

DNA & barcodingBOLD38 specimens

01Narrative

Achyra coelatalis is a moth in the family Crambidae. It was described by Francis Walker in 1859. It is found in Botswana, the Democratic Republic of the Congo, Ghana, Kenya, Réunion, Lesotho, Madagascar, Namibia, Niger, the Seychelles, South Africa, Tanzania, Zambia, Zimbabwe, Australia, India and Sri Lanka. The larvae have been recorded feeding on Sorghum species, Oryza sativa, Pennisetum americanum and Zea mays.African Moths

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding38 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Achyra coelatalis has left across the world's sequence archives.

At a glance

DNA specimens38

BINs2

Marker genes1

eDNA detections60

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus29 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

43Tmostly conserved

316Gmostly conserved

454Gmostly conserved

533Cmostly conserved

TACTTTATATTTTATTTTTGGTATTTGAAGAGGAATAGTTGGTACATCTTTAAGTATTCTTATTCGTGCTGAATTAGGTAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.42%

Haplotypes8

BINs2

Most divergent pair3.8%

AfricaAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Achyra massalissame genus6.2%Achyra affinitalissame genus6.6%Loxostege clathralissame family6.7%Loxostege virescalissame family6.7%Achyra occidentalissame genus7.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type497 records

Wild obs. + sensor483

Museum / vouchered14

Range

Area of Occupancy AOO824 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy49% within 1 km

≤100 m 156≤1 km 30≤10 km 3>10 km 192

381 georeferenced · 102 without coordinates

Open the mapobservation + sensor483

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 13 without coordinates

Open the institutions mapphysical evidence14

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Smithsonian Institution, National Museum of Natural Historylocation not on record	8
ZSMlocation not on record	1
Naturalis Biodiversity Centerlocation not on record	1
Nagatoro-machi, Chichibu-gun, JP	1
New Haven, US	1

5 institutions · 12 of 14 vouchered records shown · 2 without an institution code

09Environmental DNA60 detections

Where the DNA of Achyra coelatalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found60

Studies independent surveys1

Countries9

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 60 detections have coordinates

Open the map9 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.9 °C 19.9–30.5

Seasonal swing summer↔winter8.90 °C

Max temp (day)30.3 °C 25.0–34.6

Min temp (night)24.1 °C 14.5–25.6

Precipitation58.4 mm/mo 34.9–124

Air humidity58.3 % 53.2–62.2

Moisture balance-89.7 mm/mo -138–18.6

Vapour deficit1,451 Pa 979–1,939

Wind speed2.90 m/s 2.10–3.90

Cloud cover20.2 % 14.1–38.7

CHELSA 1981–2010, ~9 km grid, at location & month of 60 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)