Achyra massalis

(Walker, 1859) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Crambidae/Achyra

At a glance

Occurrence records410

Data sources7

Biological traits0

DNA specimens58

eDNA detections56

Sources7 archives

Databases and archives Achyra massalis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility410 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI56 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics58 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF410 records

Environmental DNA1 datasets · 1 countries56 detections

DNA & barcodingBOLD58 specimens

01Narrative

Achyra massalis, the ombava, is a moth of the family Crambidae. The species was described by Francis Walker in 1859. It is found in most of the Old World tropics, including Réunion, Namibia and Australia (including New South Wales, Queensland and Western Australia). The wingspan is about 20 mm. Adults have light to dark brown forewings with a submarginal dark band and a dark spot near the centre. The larvae are considered agricultural pests and have been recorded feeding on pearl millet (Pennisetum glaucum). They are off white, greenish or reddish and have three dark red lines along the body. They only feed at night. By day they rest in a web in the soil near the host plant.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding58 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Achyra massalis has left across the world's sequence archives.

At a glance

DNA specimens58

BINs5

Marker genes2

eDNA detections56

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus47 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 92% of positions are identical in every specimen.

Where individuals differ — all 55 variable positions, in barcode order

25Tmostly conserved

40Tmostly conserved

56Cmostly conserved

59Tmostly conserved

61Amostly conserved

67Gvariable

82Cvariable

92Cmostly conserved

115Tmostly conserved

136Cvariable

220Tmostly conserved

226Tmostly conserved

235Cmostly conserved

259Cmostly conserved

271Cmostly conserved

274Amostly conserved

340Cmostly conserved

346Amostly conserved

382Tmostly conserved

394Tmostly conserved

397Tmostly conserved

400Cmostly conserved

412Tmostly conserved

415Avariable

424Tmostly conserved

442Tmostly conserved

451Tmostly conserved

454Amostly conserved

460Tmostly conserved

466Amostly conserved

470Gmostly conserved

472Tmostly conserved

478Amostly conserved

490Cmostly conserved

508Amostly conserved

523Tmostly conserved

533Tmostly conserved

536Tmostly conserved

538Amostly conserved

539Tmostly conserved

542Cmostly conserved

544Tmostly conserved

547Cvariable

548Cvariable

581Tmostly conserved

583Amostly conserved

589Cvariable

613Tmostly conserved

616Tmostly conserved

625Amostly conserved

628Tmostly conserved

634Tmostly conserved

641Tmostly conserved

653Tvariable

658Tmostly conserved

TACTTTATATTTTATTTTTGGAATTTGAAGAGGAATAGTTGGTACATCTTTAAGTCTTTTAATTCGGGCTGAATTAGGTAACCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.5%

Haplotypes12

BINs5

Most divergent pair6.7%

OceaniaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Achyra takowensissame genus6.1%Achyra coelatalissame genus6.2%Achyra occidentalissame genus6.4%Palepicorsia ustrinalissame family6.5%Hahncappsia ramsdenalissame family6.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type410 records

Wild obs. + sensor395

Museum / vouchered15

Range

Area of Occupancy AOO604 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 171≤1 km 128≤10 km 29>10 km 12

340 georeferenced · 55 without coordinates

Open the mapobservation + sensor395

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤1 km 1≤10 km 1

2 georeferenced · 13 without coordinates

Open the institutions mapphysical evidence15

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Australian National Insect Collectionlocation not on record	6
Australian National Fish Collectionlocation not on record	2
Bavarian State Collection of Zoologylocation not on record	1
Natural History Museum Rotterdamlocation not on record	1
DPIlocation not on record	1

5 institutions · 11 of 15 vouchered records shown · 4 without an institution code

09Environmental DNA56 detections

Where the DNA of Achyra massalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found56

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 56 detections have coordinates

Open the map1 country0

Dry Sclerophyll ForestUrban

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.8 °C 22.4–27.5

Seasonal swing summer↔winter8.60 °C

Max temp (day)24.7 °C 23.8–30.0

Min temp (night)20.9 °C 19.0–24.4

Precipitation118 mm/mo 110–270

Air humidity61.6 % 59.3–62.5

Vapour deficit1,096 Pa 1,019–1,442

Cloud cover27.4 % 24.9–55.8

CHELSA 1981–2010, ~9 km grid, at location & month of 55 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)