Achyra occidentalis

Packard, 1873 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Crambidae/Achyra

At a glance

Occurrence records185

Data sources7

Biological traits0

DNA specimens24

eDNA detections23

Sources7 archives

Databases and archives Achyra occidentalis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility185 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI23 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics24 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF185 records

Environmental DNA1 datasets · 1 countries23 detections

DNA & barcodingBOLD24 specimens

01Narrative

Achyra occidentalis is a moth in the family Crambidae. It was described by Packard in 1873. It is found in North America, where it has been recorded from Arizona, California and Nevada.mothphotographersgroup The length of the forewings is 10 –. There are two forms, a dark and pale form. Adults of the dark form are on wing from March to April, while those of the pale form are on wing from June to August.Bug Guide

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding24 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Achyra occidentalis has left across the world's sequence archives.

At a glance

DNA specimens24

BINs1

Marker genes1

eDNA detections23

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus21 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

166Gmostly conserved

460Tmostly conserved

TACTTTATATTTTATTTTTGGAATCTGAAGAGGAATAGTTGGTACATCTTTAAGTCTTTTAATTCGTGCTGAATTAGGTAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.10%

Haplotypes5

BIN1

Most divergent pair0.30%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Achyra rantalissame genus5.0%Achyra affinitalissame genus6.0%Achyra nigrirenalissame genus6.2%Loxostege nudalissame family6.4%Loxostege virescalissame family6.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type185 records

Wild obs. + sensor14

Museum / vouchered171

Range

Area of Occupancy AOO224 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy60% within 1 km

≤100 m 5≤1 km 1≤10 km 2>10 km 2

10 georeferenced · 4 without coordinates

Open the mapobservation + sensor14

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy81% within 1 km

≤100 m 8≤1 km 52≤10 km 8>10 km 6

74 georeferenced · 97 without coordinates

Open the institutions mapphysical evidence171

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Santa Barbara Museum of Natural Historylocation not on record	84
Santa Cruz, US	50
San Diego, US	9
San Francisco, US	4
New Haven, US	3
Canadian National Collection of Insects, Arachnids and Nematodeslocation not on record	3
Denver, US	2
Georgia Museum of Natural Historylocation not on record	2
Cambridge, US	1
Mississippi State, US	1
US	1
Essig Museum of Entomologylocation not on record	1

12 institutions · 161 of 171 vouchered records shown · 10 without an institution code

09Environmental DNA23 detections

Where the DNA of Achyra occidentalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found23

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 23 detections have coordinates

Open the map1 country0

3. Shrubland | 3.4. Temperate ShrublandUrban

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.4 °C 13.8–27.1

Seasonal swing summer↔winter18.5 °C

Max temp (day)24.8 °C 19.0–35.0

Min temp (night)12.6 °C 7.20–18.9

Precipitation14.5 mm/mo 1.00–48.3

Air humidity47.9 % 42.2–60.5

Moisture balance-110 mm/mo -183–-44.5

Vapour deficit1,017 Pa 705–2,018

Wind speed2.40 m/s 1.30–3.30

Cloud cover27.9 % 12.7–43.2

CHELSA 1981–2010, ~9 km grid, at location & month of 23 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)