Achyra rantalis

Guenée, 1854 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Crambidae/Achyra

At a glance

Occurrence records11 577

Data sources7

Biological traits0

DNA specimens88

eDNA detections116

Sources7 archives

Databases and archives Achyra rantalis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility11 577 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI116 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics88 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF11 577 records

Environmental DNA1 datasets · 3 countries116 detections

DNA & barcodingBOLD88 specimens

01Narrative

Achyra rantalis, the garden webworm, is a moth of the family Crambidae described by Achille Guenée in 1854. It is found in North America, where it has been recorded from Maine to southern Quebec and Ontario, south to Florida and Mexico. It has also been recorded from Iowa, Colorado, California and the West Indies. Its habitat consists of fields and gardens. Caterpillar The wingspan is 17 –. There may be up to four generations per year in the south. The larvae feed on the leaves of various low-growing plants, including alfalfa, beans, clover, corn, cotton, peas and strawberries."Species Achyra rantalis - Garden Webworm Moth - Hodges#4975". BugGuide. Retrieved January 19, 2018.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding88 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Achyra rantalis has left across the world's sequence archives.

At a glance

DNA specimens88

BINs1

Marker genes1

eDNA detections116

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus83 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

TACTTTATATTTTATTTTTGGAATTTGAAGAGGAATAGTTGGTACTTCTTTAAGTCTTCTAATTCGTGCCGAATTAGGTAACCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.07%

Haplotypes10

BIN1

Most divergent pair0.76%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Achyra occidentalissame genus5.0%Achyra affinitalissame genus5.6%Achyra eneanalissame genus6.2%Neohelvibotys arizonensissame family6.4%Loxostege nudalissame family6.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type11 577 records

Wild obs. + sensor11 118

Museum / vouchered459

Range

Area of Occupancy AOO17 356 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 6 154≤1 km 1 553≤10 km 341>10 km 1 144

9 192 georeferenced · 1 926 without coordinates

Open the mapobservation + sensor11 118

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy14% within 1 km

≤100 m 19≤1 km 25≤10 km 181>10 km 95

320 georeferenced · 139 without coordinates

Open the institutions mapphysical evidence459

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
King Saud Universitylocation not on record	108
Mississippi State, US	70
ASUlocation not on record	43
New Haven, US	37
East Lansing, US	36
San Diego, US	18
CUlocation not on record	16
Santa Barbara Museum of Natural Historylocation not on record	14
Georgia Museum of Natural Historylocation not on record	13
Cambridge, US	10
St. Paul, US	8
North Carolina State University Insect Museumlocation not on record	7
Canadian National Collection of Insects, Arachnids and Nematodeslocation not on record	4
Facultad de Ciencias Biológicas y Agropecuarias, Universidad de Colimalocation not on record	4
Albuquerque, US	3
US	3
Awka, NG	2
Decorah, US	2
Washington, US	2
Denver, US	1
San Francisco, US	1
SOVTlocation not on record	1
Oregon State Arthropod Collectionlocation not on record	1
Toronto, CA	1
Champaign, US	1
Essig Museum of Entomologylocation not on record	1

26 institutions · 407 of 459 vouchered records shown · 52 without an institution code

09Environmental DNA116 detections

Where the DNA of Achyra rantalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found116

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 116 detections have coordinates

Open the map3 countries0

Agricultural

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.1 °C 18.6–30.9

Seasonal swing summer↔winter22.6 °C

Max temp (day)29.5 °C 24.9–36.7

Min temp (night)18.2 °C 12.0–23.8

Precipitation63.8 mm/mo 2.50–113

Air humidity51.1 % 37.2–59.6

Moisture balance-116 mm/mo -208–-31.4

Vapour deficit1,470 Pa 958–2,792

Wind speed3.40 m/s 2.30–5.30

Cloud cover28.7 % 12.9–37.2

CHELSA 1981–2010, ~9 km grid, at location & month of 114 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Achyra rantalis

At a glance

Sources7 archives

At a glance

Record type11 577 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions15 of 26 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type11 577 records