Achyra affinitalis

(Lederer, 1863) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Crambidae/Achyra

At a glance

Occurrence records3 018

Data sources7

Biological traits0

DNA specimens894

eDNA detections894

Sources7 archives

Databases and archives Achyra affinitalis's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 018 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI894 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics894 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF3 018 records

Environmental DNA1 datasets · 3 countries894 detections

DNA & barcodingBOLD894 specimens

01Narrative

Achyra affinitalis, the cotton web spinner, is a moth of the family Crambidae. It was described by Julius Lederer in 1863 and is found in Australia and New Zealand.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding894 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Achyra affinitalis has left across the world's sequence archives.

At a glance

DNA specimens894

BINs1

Marker genes3

eDNA detections894

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus888 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

81Tvariable

99Gvariable

360Cmostly conserved

414Amostly conserved

498Cmostly conserved

556Tmostly conserved

ACTTTATATTTTATTTTTGGAATTTGAAGAGGAATAGTTGGAACATCTTTAAGTCTTCTTATTCGTGCTGAATTAGGTAATCCTGGATCA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 28 commonest of 69 variants.

Diversity (π)0.39%

Haplotypes69

BIN1

Most divergent pair1.2%

OceaniaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Achyra nigrirenalissame genus3.2%Achyra eneanalissame genus4.9%Loxostege nudalissame family5.2%Achyra bifidalissame genus5.5%Achyra nudalissame genus5.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5PEF1-alpha

animal barcoderibosomalmarker

08Occurrence & distribution

Record type3 018 records

Wild obs. + sensor2 259

Museum / vouchered401

Other358

Origin

Native12

Range

Area of Occupancy AOO3 432 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 1 075≤1 km 299≤10 km 64>10 km 209

1 647 georeferenced · 612 without coordinates

Open the mapobservation + sensor2 259

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy92% within 1 km

≤100 m 19≤1 km 5≤10 km 2

26 georeferenced · 375 without coordinates

Open the institutions mapphysical evidence401

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DPIlocation not on record	256
MWLRlocation not on record	10
Tasmanian Museum & Art Gallerylocation not on record	9
Sydney, AU	9
New Zealand Arthropod Collectionlocation not on record	5
Auckland, NZ	2
New Haven, US	1
Natick, US	1
Australian National Insect Collectionlocation not on record	1

9 institutions · 294 of 401 vouchered records shown · 107 without an institution code

09Environmental DNA894 detections

Where the DNA of Achyra affinitalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found894

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 894 detections have coordinates

Open the map3 countries0

Urban14. Artificial - Terrestrial | 14.5 Urban Ar…Grassland3. Shrubland|3.8. Mediterranean-type Shrubby…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.7 °C 16.8–25.0

Seasonal swing summer↔winter14.5 °C

Max temp (day)31.2 °C 22.1–31.6

Min temp (night)18.4 °C 11.5–18.4

Precipitation15.1 mm/mo 14.5–70.0

Air humidity46.7 % 46.1–57.2

Moisture balance-143 mm/mo -161–-49.7

Vapour deficit1,653 Pa 838–1,708

Wind speed3.00 m/s 2.70–4.10

Cloud cover17.4 % 17.4–24.1

CHELSA 1981–2010, ~9 km grid, at location & month of 891 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Achyra affinitalis

At a glance

Sources7 archives

At a glance

Record type3 018 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 9 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 018 records