Achyra bifidalis

Fabricius, 1794 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Crambidae/Achyra

At a glance

Occurrence records638

Data sources7

Biological traits0

DNA specimens8

eDNA detections3

Sources7 archives

Databases and archives Achyra bifidalis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility638 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF638 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD8 specimens

01Narrative

Achyra bifidalis is a moth in the family Crambidae. It was described by Johan Christian Fabricius in 1794. It is found from the southern United States (from Arizona to Florida) south through Mexico to Brazil and Argentina. It is also found in the West Indies. The wingspan is 20 –. The larvae feed on Gossypium and Portulaca species. They reach a length of 24–27 mm."Species Achyra bifidalis - Hodges#4974". BugGuide. Retrieved January 19, 2018.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Achyra bifidalis has left across the world's sequence archives.

At a glance

DNA specimens8

BINs1

Marker genes1

eDNA detections3

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

TACATTATATTTTATTTTTGGAATTTGAAGAGGAATAGTAGGAACATCTTTAAGCCTTCTTATTCGAGCTGAATTAGGTAATCCTGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Hyalorista exuvialissame family3.0%Achyra eneanalissame genus5.3%Achyra affinitalissame genus5.5%Loxostege nudalissame family6.1%Loxostege virescalissame family6.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type638 records

Wild obs. + sensor606

Museum / vouchered32

Range

Area of Occupancy AOO1 156 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 297≤1 km 92≤10 km 14>10 km 94

497 georeferenced · 109 without coordinates

Open the mapobservation + sensor606

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy71% within 1 km

≤100 m 10≤1 km 2≤10 km 5

17 georeferenced · 15 without coordinates

Open the institutions mapphysical evidence32

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ASUlocation not on record	9
New Haven, US	5
National Biodiversity Institute, Costa Ricalocation not on record	4
Canadian National Collection of Insects, Arachnids and Nematodeslocation not on record	3
Ciudad de México, MX	1
Mississippi State, US	1
University of Alberta Museums (UAM)location not on record	1
Washington, US	1
RMNHlocation not on record	1

9 institutions · 26 of 32 vouchered records shown · 6 without an institution code

09Environmental DNA3 detections

Where the DNA of Achyra bifidalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.2 °C 22.9–27.2

Seasonal swing summer↔winter4.80 °C

Max temp (day)27.2 °C 26.4–29.2

Min temp (night)19.2 °C 19.2–24.9

Precipitation233 mm/mo 176–606

Air humidity67.9 % 65.6–68.9

Moisture balance87.6 mm/mo 0.4–450

Vapour deficit912 Pa 870–1,246

Wind speed2.30 m/s 0.9–2.60

Cloud cover33.0 % 29.8–33.9

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)