Achyra nudalis

Hübner, 1796 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Crambidae/Achyra

At a glance

Occurrence records2 986

Data sources7

Biological traits0

DNA specimens35

eDNA detections3

Sources7 archives

Databases and archives Achyra nudalis's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 986 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics35 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 986 records

Environmental DNA1 datasets · 2 countries3 detections

DNA & barcodingBOLD35 specimens

01Narrative

Achyra nudalis is a moth of the family Crambidae. It was described by Jacob Hübner in 1796. It is found from southern Europe east to India and Mongolia. It has also been recorded from Yemen, Niger, Saudi Arabia and South Africa.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding35 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Achyra nudalis has left across the world's sequence archives.

At a glance

DNA specimens35

BINs2

Marker genes1

eDNA detections3

Countries12

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus33 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 86% of positions are identical in every specimen.

Where individuals differ — all 93 variable positions, in barcode order

1Cmostly conserved

10Tmostly conserved

29Amostly conserved

30Gmostly conserved

38Amostly conserved

40Tmostly conserved

43Tmostly conserved

50Tmostly conserved

52Amostly conserved

56Cmostly conserved

58Tmostly conserved

59Cmostly conserved

61Tmostly conserved

67Tmostly conserved

79Tmostly conserved

81Amostly conserved

85Tmostly conserved

88Cmostly conserved

91Amostly conserved

92Cmostly conserved

100Tmostly conserved

121Amostly conserved

139Amostly conserved

142Cmostly conserved

163Tmostly conserved

166Amostly conserved

169Amostly conserved

190Amostly conserved

205Cmostly conserved

220Tmostly conserved

238Cmostly conserved

241Amostly conserved

256Amostly conserved

263Tmostly conserved

265Amostly conserved

266Tmostly conserved

268Amostly conserved

271Cmostly conserved

274Amostly conserved

277Cmostly conserved

281Amostly conserved

282Cmostly conserved

283Tmostly conserved

295Amostly conserved

301Amostly conserved

307Tmostly conserved

325Cmostly conserved

337Amostly conserved

349Cmostly conserved

352Amostly conserved

361Tmostly conserved

379Amostly conserved

386Tmostly conserved

388Amostly conserved

401Cmostly conserved

403Tmostly conserved

421Amostly conserved

424Amostly conserved

428Cmostly conserved

433Amostly conserved

451Tmostly conserved

467Cmostly conserved

468Gmostly conserved

474Amostly conserved

475Cvariable

482Tmostly conserved

483Cmostly conserved

484Amostly conserved

514Amostly conserved

517Amostly conserved

532Amostly conserved

533Cmostly conserved

535Tmostly conserved

536Tmostly conserved

538Amostly conserved

544Tmostly conserved

548Cmostly conserved

553Tmostly conserved

556Amostly conserved

562Amostly conserved

565Tmostly conserved

578Cmostly conserved

586Amostly conserved

589Tmostly conserved

604Amostly conserved

607Amostly conserved

616Cmostly conserved

619Tmostly conserved

622Tmostly conserved

628Tmostly conserved

634Tmostly conserved

637Tmostly conserved

646Tmostly conserved

CACTTTATATTTTATTTTTGGAATTTGAAGAGGAATAATTGGTACATCTTTAAGTCTTCTTATTCGTGCTGAATTAGGTAATCCTGGCTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.0%

Haplotypes8

BINs2

Most divergent pair13.7%

EuropeAfricaAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Achyra affinitalissame genus5.5%Achyra eneanalissame genus5.9%Achyra bifidalissame genus6.4%Achyra nigrirenalissame genus6.5%Hyalorista exuvialissame family6.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 986 records

Wild obs. + sensor2 806

Museum / vouchered164

Other16

Origin

Native13

Range

Area of Occupancy AOO4 916 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 1 069≤1 km 325≤10 km 137>10 km 202

1 733 georeferenced · 1 073 without coordinates

Open the mapobservation + sensor2 806

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy39% within 1 km

≤100 m 4≤1 km 7≤10 km 11>10 km 6

28 georeferenced · 136 without coordinates

Open the institutions mapphysical evidence164

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ZAF-UMUlocation not on record	126
Zürich, CH	24
MZLUlocation not on record	4
Philadelphia, US	1
Canadian National Collection of Insects, Arachnids and Nematodeslocation not on record	1

5 institutions · 156 of 164 vouchered records shown · 8 without an institution code

09Environmental DNA3 detections

Where the DNA of Achyra nudalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.7 °C 20.1–23.9

Seasonal swing summer↔winter10.9 °C

Max temp (day)25.6 °C 25.1–27.8

Min temp (night)15.2 °C 14.6–19.8

Precipitation117 mm/mo 104–185

Air humidity57.2 % 56.9–63.6

Moisture balance-49.1 mm/mo -58.9–32.6

Vapour deficit1,055 Pa 1,010–1,073

Wind speed2.90 m/s 2.60–3.60

Cloud cover32.4 % 31.7–36.3

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Achyra nudalis

At a glance

Sources7 archives

At a glance

Record type2 986 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions2 of 5 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 986 records