Acharia stimulea

(Clemens, 1860) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Limacodidae/Acharia

At a glance

Occurrence records5 522

Data sources6

Biological traits0

DNA specimens20

eDNA detections24

Sources6 archives

Databases and archives Acharia stimulea's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 522 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI24 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics20 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF5 522 records

Environmental DNA1 datasets · 1 countries24 detections

DNA & barcodingBOLD20 specimens

01Narrative

Acharia stimulea ist ein in Nordamerika vorkommender Schmetterling (Nachtfalter) aus der Familie der Schneckenspinner (Limacodidae).

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding20 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acharia stimulea has left across the world's sequence archives.

At a glance

DNA specimens20

BINs2

Marker genes2

eDNA detections24

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus18 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 92% of positions are identical in every specimen.

Where individuals differ — all 50 variable positions, in barcode order

4Amostly conserved

16Tmostly conserved

34Amostly conserved

41Gmostly conserved

49Tmostly conserved

50Tmostly conserved

56Tmostly conserved

58Amostly conserved

59Tmostly conserved

73Amostly conserved

76Gmostly conserved

79Amostly conserved

82Tmostly conserved

103Tmostly conserved

118Cmostly conserved

193Cmostly conserved

220Cmostly conserved

238Cmostly conserved

250Tmostly conserved

263Cmostly conserved

265Amostly conserved

271Cmostly conserved

286Tmostly conserved

287Cmostly conserved

295Gmostly conserved

304Tmostly conserved

316Amostly conserved

343Cmostly conserved

352Tmostly conserved

364Cmostly conserved

370Tmostly conserved

382Amostly conserved

394Tmostly conserved

433Amostly conserved

463Tvariable

469Tvariable

499Cvariable

526Amostly conserved

538Gmostly conserved

547Tmostly conserved

562Cmostly conserved

565Amostly conserved

580Amostly conserved

583Cmostly conserved

616Tmostly conserved

622Cmostly conserved

639Tmostly conserved

640Tvariable

653Tmostly conserved

658Cmostly conserved

AACAATATATTTTATTTTTGGAATCTGATCAGGAATAGTAGGAACATCTTTAAGATTATTAATTCGAGCTGAATTGGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.6%

Haplotypes11

BINs2

Most divergent pair4.9%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acharia saranssame genus6.2%Acharia hyperochesame genus6.2%Acharia ophelianssame genus6.4%Phocoderma velutinasame family8.1%Euclea gajentaanisame family8.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type5 522 records

Wild obs. + sensor5 393

Museum / vouchered129

Range

Area of Occupancy AOO15 620 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 2 881≤1 km 728≤10 km 340>10 km 649

4 598 georeferenced · 795 without coordinates

Open the mapobservation + sensor5 393

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy12% within 1 km

≤100 m 2≤1 km 5≤10 km 49>10 km 4

60 georeferenced · 69 without coordinates

Open the institutions mapphysical evidence129

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mississippi State, US	47
New Haven, US	35
East Lansing, US	6
CUlocation not on record	5
Denver, US	4
Cambridge, US	4
OSUClocation not on record	4
Washington, US	4
Corporación Centro de Investigación en Palma de Aceite - CENIPALMAlocation not on record	4
Tapachula, MX	2
Champaign, US	2
Montgomery, US	1
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Toronto, CA	1
Smithsonian Institution, National Museum of Natural Historylocation not on record	1
Garðabær, IS	1
Cleveland Museum of Natural History, OH (CLEV)location not on record	1
University of Central Floridalocation not on record	1

18 institutions · 124 of 129 vouchered records shown · 5 without an institution code

09Environmental DNA24 detections

Where the DNA of Acharia stimulea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found24

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 24 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.5 °C 20.1–27.1

Seasonal swing summer↔winter14.8 °C

Max temp (day)28.9 °C 25.7–31.1

Min temp (night)21.1 °C 15.3–24.4

Precipitation115 mm/mo 75.5–197

Air humidity58.9 % 56.8–62.3

Moisture balance-50.6 mm/mo

Vapour deficit1,318 Pa 1,003–1,431

Wind speed3.20 m/s

Cloud cover31.1 % 29.2–34.3

CHELSA 1981–2010, ~9 km grid, at location & month of 14 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acharia stimulea

At a glance

Sources6 archives

At a glance

Record type5 522 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 18 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type5 522 records