Acharia sarans

species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Limacodidae/Acharia

At a glance

Occurrence records348

Data sources4

Biological traits0

DNA specimens45

eDNA detections44

Sources4 archives

Databases and archives Acharia sarans's data was compiled from.

GBIFGlobal Biodiversity Information Facility348 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI44 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics45 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF348 records

Environmental DNA1 datasets · 1 countries44 detections

DNA & barcodingBOLD45 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding45 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acharia sarans has left across the world's sequence archives.

At a glance

DNA specimens45

BINs1

Marker genes1

eDNA detections44

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus43 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

58Gmostly conserved

389Gmostly conserved

406Cmostly conserved

556Tmostly conserved

AACAATATATTTTATTTTTGGAATCTGATCTGGAATAGTAGGAACATCTTTAAGATTGCTAATTCGAGCTGAATTAGGAAATCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.16%

Haplotypes8

BIN1

Most divergent pair0.76%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acharia stimuleasame genus6.2%Acharia ophelianssame genus7.1%Acharia hyperochesame genus8.2%Monoleuca subdentosasame family8.5%Euclea norbasame family8.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type348 records

Wild obs. + sensor25

Museum / vouchered323

Range

Area of Occupancy AOO300 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy70% within 1 km

≤100 m 10≤1 km 4≤10 km 4>10 km 2

20 georeferenced · 5 without coordinates

Open the mapobservation + sensor25

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 323 records without

Open the institutions mapphysical evidence323

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
National Biodiversity Institute, Costa Ricalocation not on record	301
University of Pennsylvanialocation not on record	2

2 institutions · 303 of 323 vouchered records shown · 20 without an institution code

09Environmental DNA44 detections

Where the DNA of Acharia sarans was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found44

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 44 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.9 °C 24.1–26.2

Seasonal swing summer↔winter2.50 °C

Max temp (day)27.5 °C 27.2–29.9

Min temp (night)22.3 °C 21.4–23.3

Precipitation356 mm/mo 257–412

Air humidity69.1 % 66.0–73.3

Moisture balance203 mm/mo 103–275

Vapour deficit939 Pa 843–1,158

Wind speed2.50 m/s 1.00–3.30

Cloud cover42.5 % 31.5–44.7

CHELSA 1981–2010, ~9 km grid, at location & month of 44 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)