Acharia hyperoche

species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Limacodidae/Acharia

At a glance

Occurrence records454

Data sources5

Biological traits0

DNA specimens66

eDNA detections63

Sources5 archives

Databases and archives Acharia hyperoche's data was compiled from.

GBIFGlobal Biodiversity Information Facility454 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI63 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics66 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF454 records

Environmental DNA1 datasets · 2 countries63 detections

DNA & barcodingBOLD66 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding66 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acharia hyperoche has left across the world's sequence archives.

At a glance

DNA specimens66

BINs1

Marker genes1

eDNA detections63

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus62 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 1 variable positions, in barcode order

369Gmostly conserved

AACAATATATTTTATCTTTGGAATTTGATCAGGAATAGTCGGAACATCTTTAAGATTATTAATTCGAGCTGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.06%

Haplotypes5

BIN1

Most divergent pair0.46%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acharia ophelianssame genus5.5%Acharia stimuleasame genus6.2%Adoneta geminasame family7.8%Monoleuca subdentosasame family7.8%Euclea distrahenssame family7.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type454 records

Wild obs. + sensor326

Museum / vouchered128

Range

Area of Occupancy AOO996 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 134≤1 km 91≤10 km 28>10 km 16

269 georeferenced · 57 without coordinates

Open the mapobservation + sensor326

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 128 records without

Open the institutions mapphysical evidence128

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
National Biodiversity Institute, Costa Ricalocation not on record	121
University of Pennsylvanialocation not on record	3
Universidad de Sucre (UniSucre)location not on record	1

3 institutions · 125 of 128 vouchered records shown · 3 without an institution code

09Environmental DNA63 detections

Where the DNA of Acharia hyperoche was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found63

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 63 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.9 °C 23.4–25.0

Seasonal swing summer↔winter2.30 °C

Max temp (day)26.8 °C 25.6–28.2

Min temp (night)21.8 °C 20.7–22.2

Precipitation403 mm/mo 162–478

Air humidity74.7 % 68.3–75.7

Moisture balance264 mm/mo 38.9–344

Vapour deficit748 Pa 707–1,022

Wind speed1.30 m/s 1.00–2.80

Cloud cover39.1 % 18.8–45.8

CHELSA 1981–2010, ~9 km grid, at location & month of 59 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)