Acharia ophelians

species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Limacodidae/Acharia

At a glance

Occurrence records282

Data sources4

Biological traits0

DNA specimens118

eDNA detections115

Sources4 archives

Databases and archives Acharia ophelians's data was compiled from.

GBIFGlobal Biodiversity Information Facility282 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI115 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics118 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF282 records

Environmental DNA1 datasets · 1 countries115 detections

DNA & barcodingBOLD118 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding118 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acharia ophelians has left across the world's sequence archives.

At a glance

DNA specimens118

BINs1

Marker genes1

eDNA detections115

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus114 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 5 variable positions, in barcode order

166Amostly conserved

220Cmostly conserved

403Gmostly conserved

472Cmostly conserved

646Tvariable

AACAATATATTTTATTTTTGGAATTTGATCAGGAATAGTAGGAACATCATTAAGATTATTAATTCGAGCTGAACTAGGAAATCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.24%

Haplotypes6

BIN1

Most divergent pair0.61%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acharia hyperochesame genus5.5%Acharia stimuleasame genus6.4%Monoleuca subdentosasame family6.8%Acharia saranssame genus7.1%Nystalea virgulasame order7.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type282 records

Wild obs. + sensor51

Museum / vouchered231

Range

Area of Occupancy AOO404 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 18≤1 km 18≤10 km 3>10 km 1

40 georeferenced · 11 without coordinates

Open the mapobservation + sensor51

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2>10 km 1

3 georeferenced · 228 without coordinates

Open the institutions mapphysical evidence231

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Biodiversity Institute, Costa Ricalocation not on record	219
New Haven, US	3
University of Pennsylvanialocation not on record	2
Research Collection of D. H. Janzen & W. Hallwachslocation not on record	1

4 institutions · 225 of 231 vouchered records shown · 6 without an institution code

09Environmental DNA115 detections

Where the DNA of Acharia ophelians was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found115

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 115 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.5 °C 23.2–25.7

Seasonal swing summer↔winter2.40 °C

Max temp (day)27.3 °C 25.9–29.6

Min temp (night)22.1 °C 20.7–22.8

Precipitation313 mm/mo 151–485

Air humidity70.3 % 64.4–75.5

Moisture balance173 mm/mo -11.9–349

Vapour deficit899 Pa 717–1,172

Wind speed2.70 m/s 1.10–4.40

Cloud cover34.2 % 18.6–45.8

CHELSA 1981–2010, ~9 km grid, at location & month of 106 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)