Achaea mercatoria

(Fabricius, 1775) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Achaea

At a glance

Occurrence records28

Data sources6

Biological traits0

DNA specimens12

eDNA detections7

Sources6 archives

Databases and archives Achaea mercatoria's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility28 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF28 records

Environmental DNA1 datasets · 1 countries7 detections

DNA & barcodingBOLD12 specimens

01Narrative

Achaea mercatoria is a moth of the family Erebidae. It is found in countries in tropical Africa and Asia, from South Africa to South East Asia, including the Near East (Saudi Arabia and Yemen) and the islands of Madagascar, Seychelles and Cabo Verde.afromoths.net It has been identified in north-western Australia only in 1978 from specimen collected back to 1968, which had previously been confused with Achaea serva. This species has a wingspan of 56-66mm. One of the foodplants of the larvae is Ricinus communis.Edwards, 1978, A Review of the Genus ACHAEA Hübner in Australia – Australian Journal of Entomology, Volume 17(4): 329–340

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Achaea mercatoria has left across the world's sequence archives.

At a glance

DNA specimens12

BINs2

Marker genes1

eDNA detections7

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 17 variable positions, in barcode order

92Tvariable

127Avariable

148Amostly conserved

160Gvariable

166Gvariable

235Cmostly conserved

238Cvariable

313Cvariable

328Gvariable

340Cmostly conserved

418Tvariable

532Tvariable

577Amostly conserved

604Tvariable

616Cvariable

640Cvariable

641Tvariable

AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGAACATCTTTAAGTTTATTAATTCGAGCTGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.2%

Haplotypes4

BINs2

Most divergent pair2.1%

AfricaOceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Achaea eusciastasame genus3.5%Achaea servasame genus4.0%Achaea catellasame genus4.3%Achaea illustratasame genus4.3%Achaea echosame genus4.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type28 records

Wild obs. + sensor8

Museum / vouchered20

Range

Area of Occupancy AOO48 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 6≤10 km 1

7 georeferenced · 1 without coordinates

Open the mapobservation + sensor8

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 20 records without

Open the institutions mapphysical evidence20

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Durban Natural Science Museumlocation not on record	10
Helsinki, FI	3

2 institutions · 13 of 20 vouchered records shown · 7 without an institution code

09Environmental DNA7 detections

Where the DNA of Achaea mercatoria was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median27.2 °C 27.2–27.2

Seasonal swing summer↔winter3.40 °C

Max temp (day)28.0 °C 28.0–28.1

Min temp (night)26.4 °C

Precipitation170 mm/mo 165–170

Air humidity63.6 % 63.4–63.6

Moisture balance-34.2 mm/mo

Vapour deficit1,317 Pa 1,317–1,324

Wind speed3.60 m/s

Cloud cover21.4 % 21.2–21.4

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)