Achaea catella

Guenée, 1852 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Achaea

At a glance

Occurrence records612

Data sources7

Biological traits0

DNA specimens18

eDNA detections9

Sources7 archives

Databases and archives Achaea catella's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility612 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics18 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF612 records

Environmental DNA1 datasets · 4 countries9 detections

DNA & barcodingBOLD18 specimens

01Narrative

Achaea catella, the banded achaea, is a moth of the family Erebidae. The species was first described by Achille Guenée in 1852. It is found in Africa, including Senegal, South Africa, Réunion and Namibia.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding18 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Achaea catella has left across the world's sequence archives.

At a glance

DNA specimens18

BINs3

Marker genes1

eDNA detections9

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus17 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 30 variable positions, in barcode order

59Tvariable

70Avariable

79Amostly conserved

100Amostly conserved

124Tmostly conserved

133Tmostly conserved

157Cmostly conserved

202Tvariable

211Amostly conserved

220Cmostly conserved

247Tvariable

278Tvariable

313Tvariable

340Cvariable

364Amostly conserved

397Tmostly conserved

400Cvariable

412Tvariable

445Tvariable

478Tvariable

490Tmostly conserved

500Tvariable

532Cmostly conserved

535Cmostly conserved

556Tvariable

562Tvariable

571Tvariable

574Tvariable

613Tmostly conserved

616Tmostly conserved

AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGAACTTCTTTAAGTTTATTAATTCGAGCAGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.9%

Haplotypes7

BINs3

Most divergent pair3.5%

AsiaAfrica

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Achaea janatasame genus1.5%Achaea oedipodinasame genus2.4%Achaea illustratasame genus2.6%Achaea indeterminatasame genus2.9%Achaea chrysoperasame genus3.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type612 records

Wild obs. + sensor577

Museum / vouchered35

Range

Area of Occupancy AOO1 412 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 277≤1 km 68≤10 km 23>10 km 22

390 georeferenced · 187 without coordinates

Open the mapobservation + sensor577

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy78% within 1 km

≤100 m 5≤1 km 2≤10 km 2

9 georeferenced · 26 without coordinates

Open the institutions mapphysical evidence35

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Durban Natural Science Museumlocation not on record	9
National Museums of Kenyalocation not on record	7
Tartu, EE	4
ZSMlocation not on record	4
Muséum d'histoire naturelle de Marseillelocation not on record	3
Natural History Museum Rotterdamlocation not on record	2

6 institutions · 29 of 35 vouchered records shown · 6 without an institution code

09Environmental DNA9 detections

Where the DNA of Achaea catella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map4 countries0

Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.8 °C 19.7–29.6

Seasonal swing summer↔winter4.60 °C

Max temp (day)24.0 °C 23.9–35.2

Min temp (night)15.5 °C 15.4–23.3

Precipitation72.4 mm/mo 23.6–215

Air humidity65.3 % 48.1–66.6

Moisture balance83.3 mm/mo

Vapour deficit797 Pa 796–2,150

Wind speed2.80 m/s

Cloud cover24.7 % 19.9–31.1

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)