Achaea serva

(Fabricius, 1775) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Achaea

At a glance

Occurrence records787

Data sources6

Biological traits0

DNA specimens45

eDNA detections24

Sources6 archives

Databases and archives Achaea serva's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility787 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI24 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics45 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF787 records

Environmental DNA1 datasets · 2 countries24 detections

DNA & barcodingBOLD45 specimens

01Narrative

Achaea serva is a species of noctuid moth of the family Erebidae first described by Johan Christian Fabricius in 1775. It is found from the Indo-Australian tropics of India, Sri Lanka, Myanmar, China, Borneo, Hong Kong, Java, the Philippines, the New Hebrides, to Okinawa, many western Micronesian islands and New Guinea and Australia.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding45 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Achaea serva has left across the world's sequence archives.

At a glance

DNA specimens45

BINs3

Marker genes2

eDNA detections24

Countries10

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus35 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 31 variable positions, in barcode order

5Tvariable

46Cmostly conserved

74Cmostly conserved

85Cvariable

92Tmostly conserved

127Amostly conserved

148Amostly conserved

235Cvariable

238Tmostly conserved

286Cmostly conserved

298Amostly conserved

340Tmostly conserved

352Cvariable

379Amostly conserved

400Tvariable

406Tmostly conserved

412Tvariable

418Tmostly conserved

442Cvariable

477Gmostly conserved

478Amostly conserved

505Cmostly conserved

529Amostly conserved

532Tmostly conserved

581Cmostly conserved

589Tvariable

610Cmostly conserved

616Tvariable

641Tmostly conserved

646Cmostly conserved

652Tmostly conserved

AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGAACCTCTTTAAGTTTATTAATTCGAGCTGAACTAGGAAATCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.3%

Haplotypes6

BINs3

Most divergent pair4.1%

OceaniaAsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Achaea eusciastasame genus1.8%Achaea mercatoriasame genus4.0%Achaea catellasame genus4.7%Achaea albiciliasame genus4.7%Achaea illustratasame genus4.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_070293 ↗ · 13 protein · 22 tRNA · 2 rRNA

CYTBND1ND2COX1COX2ATP8ATP6COX3ND3ND5ND4ND4LND6rrnLrrnS

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type787 records

Wild obs. + sensor631

Museum / vouchered156

Range

Area of Occupancy AOO1 744 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 225≤1 km 155≤10 km 37>10 km 36

453 georeferenced · 178 without coordinates

Open the mapobservation + sensor631

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy4% within 1 km

≤100 m 1≤10 km 7>10 km 15

23 georeferenced · 133 without coordinates

Open the institutions mapphysical evidence156

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
FACTlocation not on record	35
Taiwan Forestry Research Institutelocation not on record	33
Auckland, NZ	18
Helsinki, FI	13
tesrilocation not on record	10
Museums Victorialocation not on record	8
Mangilao, GU	8
Bavarian State Collection of Zoologylocation not on record	5
ZSMlocation not on record	4
Natick, US	4
Tallinn, EE	2
Centre for Biodiversity Genomicslocation not on record	2
New Haven, US	1
Zürich, CH	1
Loyola College, Entomology Research Institutelocation not on record	1
Australian National Insect Collectionlocation not on record	1
Sydney, AU	1
DPIlocation not on record	1

18 institutions · 148 of 156 vouchered records shown · 7 without an institution code

09Environmental DNA24 detections

Where the DNA of Achaea serva was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found24

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 24 detections have coordinates

Open the map2 countries0

Western Ghats

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.1 °C 21.2–27.2

Seasonal swing summer↔winter4.40 °C

Max temp (day)26.6 °C 23.8–29.9

Min temp (night)22.9 °C 16.5–26.4

Precipitation117 mm/mo 19.2–274

Air humidity60.2 % 57.9–64.8

Vapour deficit1,189 Pa 1,030–1,291

Cloud cover37.1 % 29.0–72.9

CHELSA 1981–2010, ~9 km grid, at location & month of 21 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)