Achaea echo

Walker, 1858 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Achaea

At a glance

Occurrence records432

Data sources7

Biological traits0

DNA specimens7

eDNA detections9

Sources7 archives

Databases and archives Achaea echo's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility432 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF432 records

Environmental DNA1 datasets · 4 countries9 detections

DNA & barcodingBOLD7 specimens

01Narrative

Achaea echo Achaea echo is a species of moth of the family Erebidae. It is found from Equatorial West Africa to Zimbabwe, including Sierra Leone, Ghana and South Africa. The larvae feed on Poaceae and Panicum species, but have also been recorded on Citrus.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Achaea echo has left across the world's sequence archives.

At a glance

DNA specimens7

BINs1

Marker genes1

eDNA detections9

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

7Tmostly conserved

175Cmostly conserved

583Tmostly conserved

TTTATATTTCATTTTTGGTATTTGAGCAGGAATAGTAGGAACCTCTTTAAGTTTATTAATTCGAGCTGAATTAGGAAATCCTGGATCATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.13%

Haplotypes3

BIN1

Most divergent pair0.46%

Africa

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Achaea illustratasame genus3.8%Achaea indicabilissame genus4.0%Achaea catellasame genus4.3%Tolna variegatasame family4.4%Achaea albifimbriasame genus4.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type432 records

Wild obs. + sensor418

Museum / vouchered14

Range

Area of Occupancy AOO1 052 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 237≤1 km 45≤10 km 22>10 km 21

325 georeferenced · 93 without coordinates

Open the mapobservation + sensor418

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 13 without coordinates

Open the institutions mapphysical evidence14

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Durban Natural Science Museumlocation not on record	9
Tartu, EE	1

2 institutions · 10 of 14 vouchered records shown · 4 without an institution code

09Environmental DNA9 detections

Where the DNA of Achaea echo was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map4 countries0

3. Shrubland | 3.6. Subtropical/Tropical Moi…4. Native Grassland | 4.6. Subtropical/Tropi…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.2 °C 17.2–22.8

Seasonal swing summer↔winter8.50 °C

Max temp (day)24.6 °C 23.1–25.8

Min temp (night)14.4 °C 12.0–20.0

Precipitation102 mm/mo 39.2–207

Air humidity59.6 % 54.0–69.4

Moisture balance-30.0 mm/mo -47.8–56.5

Vapour deficit855 Pa 751–999

Wind speed2.10 m/s 1.30–3.50

Cloud cover34.5 % 14.7–51.8

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)