Achaea indicabilis

Walker, 1858 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Achaea

At a glance

Occurrence records3

Data sources7

Biological traits0

DNA specimens8

eDNA detections6

Sources7 archives

Databases and archives Achaea indicabilis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF3 records

Environmental DNA1 datasets · 3 countries6 detections

DNA & barcodingBOLD8 specimens

01Narrative

Achaea indicabilis is a species of moth of the family Erebidae first described by Francis Walker in 1858. It is found in Africa, including São Tomé, Ghana and the Gold Coast. The larvae feed on Citrus species.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Achaea indicabilis has left across the world's sequence archives.

At a glance

DNA specimens8

BINs2

Marker genes1

eDNA detections6

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 11 variable positions, in barcode order

163Avariable

199Amostly conserved

217Cmostly conserved

220Tmostly conserved

247Cvariable

271Cvariable

361Tmostly conserved

383Tmostly conserved

475Tmostly conserved

529Tmostly conserved

568Tmostly conserved

TTTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGAACCTCTTTAAGTTTACTAATTCGAGCTGAATTAGGTAATCCTGGATCATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.76%

Haplotypes3

BINs2

Most divergent pair0.61%

Africa

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Tolna variegatasame family4.0%Achaea echosame genus4.0%Tolna sypnoidessame family4.4%Achaea chrysoperasame genus4.4%Achaea catellasame genus4.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type3 records

Wild obs. + sensor1

Museum / vouchered2

Range

Area of Occupancy AOO12 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the institutions mapphysical evidence2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
National Museums of Kenyalocation not on record	1

1 institutions · 1 of 2 vouchered records shown · 1 without an institution code

09Environmental DNA6 detections

Where the DNA of Achaea indicabilis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map3 countries0

Forest / savannah patchwork

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.1 °C 23.4–25.3

Seasonal swing summer↔winter2.90 °C

Max temp (day)27.4 °C 25.8–28.4

Min temp (night)20.9 °C 20.1–24.5

Precipitation142 mm/mo 107–248

Air humidity68.1 % 66.8–69.3

Moisture balance22.0 mm/mo -39.9–127

Vapour deficit992 Pa 901–1,026

Wind speed1.20 m/s 1.00–1.80

Cloud cover47.7 % 35.9–48.9

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)