Abatus philippii

Lovén, 1871 · species

image placeholder — illustration coming later

Animalia/Echinodermata/Echinoidea/Spatangoida/Schizasteridae/Abatus

At a glance

Occurrence records729

Data sources7

Biological traits2

DNA specimens5

eDNA detections0

Sources7 archives

Databases and archives Abatus philippii's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility364 records↗

OBISOcean Biodiversity Information System365 records↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS729 records

DNA & barcodingBOLD5 specimens

01Narrative

Abatus philippii is a species of sea urchin of the family Schizasteridae. Their armour is covered with spines. It is in the genus Abatus and lives in the oceans of the southern hemisphere. Abatus philippii was first scientifically described in 1871 by Sven Lovén.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Abatus philippii has left across the world's sequence archives.

At a glance

DNA specimens5

BINs2

Marker genes1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Diversity (π)2.1%

Haplotypes1

BINs2

Where individuals differ — all 27 variable positions, in barcode order

43Avariable

82Amostly conserved

103Tmostly conserved

121Cmostly conserved

169Cmostly conserved

187Tmostly conserved

217Tmostly conserved

265Cmostly conserved

325Amostly conserved

343Tmostly conserved

349Amostly conserved

376Amostly conserved

400Amostly conserved

430Amostly conserved

481Tmostly conserved

484Gmostly conserved

487Cmostly conserved

496Cmostly conserved

517Amostly conserved

532Cmostly conserved

535Amostly conserved

536Cmostly conserved

541Tmostly conserved

547Cmostly conserved

550Amostly conserved

590Cmostly conserved

649Gvariable

AACCCTATATCTAGTATTTGGAGCCTGAGCAGGAATGGTGGGAACTGCCATGAGTGTCATTATCCGAGCAGAGCTTGCACAACCCGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Abatus cordatussame genus2.6%Abatus koehlerisame genus3.3%Abatus curvidenssame genus3.8%Abatus cavernosussame genus4.0%Abatus shackletonisame genus4.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type729 records

Wild obs. + sensor458

Museum / vouchered265

Other6

Range

Area of Occupancy AOO332 km²

Depth

0–200 m sunlit269

200–1000 m twilight24

1–4 km midnight2

>4 km abyssal0

median 2.5 m · max 1 291 m · 295 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 2≤1 km 2>10 km 2

6 georeferenced · 452 without coordinates

Open the mapobservation + sensor458

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤1 km 2≤10 km 1

3 georeferenced · 262 without coordinates

Open the institutions mapphysical evidence265

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Buenos Aires, AR	8
Washington, US	6
Earth Sciences New Zealandlocation not on record	3
CASlocation not on record	3
Paris, FR	2
Stockholm, SE	1
Museo nazionale dell'Antartidelocation not on record	1
AADClocation not on record	1
South Kensington, GB	1

9 institutions · 26 of 265 vouchered records shown · 110 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)