Abatus cavernosus

(Philippi, 1845) · species

image placeholder — illustration coming later

Animalia/Echinodermata/Echinoidea/Spatangoida/Schizasteridae/Abatus

At a glance

Occurrence records608

Data sources8

Biological traits3

DNA specimens5

eDNA detections42

Sources8 archives

Databases and archives Abatus cavernosus's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility309 records↗

OBISOcean Biodiversity Information System299 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI42 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources3 traits

Occurrence & distributionGBIF · OBIS608 records

Environmental DNA3 datasets · 3 countries42 detections

DNA & barcodingBOLD5 specimens

01Narrative

Abatus cavernosus is a species of sea urchin of the family Schizasteridae. Their armour is covered with spines. It is in the genus Abatus and lives in the sea. Abatus cavernosus was first scientifically described in 1845 by Rodolfo Philippi.Kroh, A. (2010). Abatus cavernosus (Philippi, 1845). In: Kroh, A. & Mooi, R. (2010) World Echinoidea Database. at the World Register of Marine Species. Females brood their young in a brood pouch through the gastrula stage until they are juveniles.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits1

Depth min215 m

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Abatus cavernosus has left across the world's sequence archives.

At a glance

DNA specimens5

BINs2

Marker genes2

eDNA detections42

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P689 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Diversity (π)3.1%

Haplotypes2

BINs2

Most divergent pair4.9%

Where individuals differ — all 37 variable positions, in barcode order

15Tvariable

63Avariable

84Amostly conserved

99Amostly conserved

165Tmostly conserved

168Amostly conserved

183Amostly conserved

219Cmostly conserved

234Tmostly conserved

237Cmostly conserved

243Gmostly conserved

264Amostly conserved

294Cmostly conserved

375Cmostly conserved

378Tmostly conserved

381Tmostly conserved

390Tmostly conserved

411Cmostly conserved

417Cmostly conserved

426Tmostly conserved

429Amostly conserved

432Amostly conserved

444Gmostly conserved

453Gmostly conserved

519Gmostly conserved

543Amostly conserved

558Cmostly conserved

564Gmostly conserved

570Amostly conserved

576Tmostly conserved

583Cvariable

585Gvariable

612Avariable

624Cvariable

642Avariable

654Avariable

669Cvariable

CAAATATATAAAGTTATTGTAACTGCCCACGCCCTCGTAATGATCTTCTTCATGGTAATGCCAATAATGATCGGAGGATTTGGAAACTGA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Abatus koehlerisame genus1.6%Abatus curvidenssame genus2.6%Abatus ingenssame genus3.0%Abatus shackletonisame genus3.3%Abatus philippiisame genus4.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type608 records

Wild obs. + sensor78

Museum / vouchered521

Other9

Range

Area of Occupancy AOO780 km²

Depth

0–200 m sunlit61

200–1000 m twilight60

1–4 km midnight17

>4 km abyssal1

median 231.8 m · max 4 471 m · 139 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy74% within 1 km

≤100 m 4≤1 km 10≤10 km 1>10 km 4

19 georeferenced · 59 without coordinates

Open the mapobservation + sensor78

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy32% within 1 km

≤100 m 14≤10 km 18>10 km 12

44 georeferenced · 477 without coordinates

Open the institutions mapphysical evidence521

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Stockholm, SE	19
Buenos Aires, AR	15
South Kensington, GB	14
Cambridge, US	13
Washington, US	12
BASElocation not on record	5
University of Oslo (UiO)location not on record	4
fcnym.unlp.edu.arlocation not on record	3
CASlocation not on record	2
Museo Nacional de Historia Natural de Chilelocation not on record	2
Brussels, BE	1
RBINS-Scientific Heritagelocation not on record	1

12 institutions · 91 of 521 vouchered records shown · 180 without an institution code

09Environmental DNA42 detections

Where the DNA of Abatus cavernosus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found42

Studies independent surveys3

Countries3

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 42 detections have coordinates

Open the map3 countries0

Pacific Ocean

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

Depth3,667 m 1,226–4,471

Pelagic

6 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.10 °C -0.1–10.8

Seasonal swing summer↔winter6.80 °C

Max temp (day)9.90 °C 0.4–11.2

Min temp (night)8.40 °C -0.7–10.2

Precipitation119 mm/mo 55.0–146

Air humidity63.0 % 62.5–66.3

Vapour deficit425 Pa 196–448

Cloud cover45.6 % 43.1–56.3

CHELSA 1981–2010, ~9 km grid, at location & month of 38 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)