Abatus curvidens

Mortensen, 1936 · species

image placeholder — illustration coming later

Animalia/Echinodermata/Echinoidea/Spatangoida/Schizasteridae/Abatus

At a glance

Occurrence records261

Data sources9

Biological traits3

DNA specimens6

eDNA detections6

Sources9 archives

Databases and archives Abatus curvidens's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility138 records↗

OBISOcean Biodiversity Information System123 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources3 traits

Occurrence & distributionGBIF · OBIS261 records

Environmental DNA1 datasets · 1 countries6 detections

DNA & barcodingBOLD6 specimens

01Narrative

Abatus curvidens is a species of sea urchin of the family Schizasteridae. Their armour is covered with spines. It is in the genus Abatus and lives in the sea. Abatus curvidens was first scientifically described in 1836 by Ole Mortensen.Kroh, A. (2010). Abatus curvidens Mortensen, 1836. In: Kroh, A. & Mooi, R. (2010) World Echinoidea Database. Gebaseerd op informatie uit het World Register of Marine Species, at the World Register of Marine Species.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits1

Depth max240 m

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Abatus curvidens has left across the world's sequence archives.

At a glance

DNA specimens6

BINs2

Marker genes1

eDNA detections6

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P677 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Diversity (π)2.2%

Haplotypes1

BINs2

Where individuals differ — all 38 variable positions, in barcode order

43Gvariable

70Avariable

82Gmostly conserved

103Cmostly conserved

169Gmostly conserved

181Amostly conserved

187Cmostly conserved

205Amostly conserved

208Amostly conserved

217Gmostly conserved

223Amostly conserved

235Tmostly conserved

262Amostly conserved

271Cvariable

292Amostly conserved

305Amostly conserved

343Cmostly conserved

349Gmostly conserved

376Gmostly conserved

400Cmostly conserved

430Avariable

439Tmostly conserved

481Cmostly conserved

484Tmostly conserved

487Tmostly conserved

499Tvariable

517Cvariable

532Tmostly conserved

535Gmostly conserved

536Tmostly conserved

538Gmostly conserved

541Cmostly conserved

547Tmostly conserved

550Gmostly conserved

631Amostly conserved

664Cvariable

670Gvariable

676Amostly conserved

AACCCTATATCTAGTATTTGGAGCCTGAGCAGGAATGGTGGGGACTGCCATGAGTGTCATTATCCGAGCAGAGCTTGCACAGCCCGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Abatus koehlerisame genus1.7%Abatus cavernosussame genus2.6%Abatus shackletonisame genus3.4%Amphipneustes similissame order3.6%Abatus philippiisame genus3.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type261 records

Wild obs. + sensor31

Museum / vouchered228

Other2

Range

Area of Occupancy AOO304 km²

Depth

0–200 m sunlit19

200–1000 m twilight52

1–4 km midnight0

>4 km abyssal0

median 317 m · max 923 m · 71 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 8≤1 km 2≤10 km 1

11 georeferenced · 20 without coordinates

Open the mapobservation + sensor31

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy75% within 1 km

≤1 km 6>10 km 2

8 georeferenced · 220 without coordinates

Open the institutions mapphysical evidence228

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Montgomery, US	13
Earth Sciences New Zealandlocation not on record	8
CASlocation not on record	5
Washington, US	5
South Kensington, GB	1

5 institutions · 32 of 228 vouchered records shown · 86 without an institution code

09Environmental DNA6 detections

Where the DNA of Abatus curvidens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median-4.50 °C -4.80–-4.50

Seasonal swing summer↔winter22.2 °C

Max temp (day)-3.00 °C -3.40–-3.00

Min temp (night)-7.10 °C -7.50–-7.10

Precipitation27.4 mm/mo 27.4–30.4

Air humidity48.0 % 46.8–48.0

Vapour deficit228 Pa 228–228

Cloud cover56.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)