Abatus cordatus

(Verrill, 1876) · species

image placeholder — illustration coming later

Animalia/Echinodermata/Echinoidea/Spatangoida/Schizasteridae/Abatus

At a glance

Occurrence records982

Data sources8

Biological traits2

DNA specimens3

eDNA detections1

Sources8 archives

Databases and archives Abatus cordatus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility526 records↗

OBISOcean Biodiversity Information System456 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS982 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD3 specimens

01Narrative

Abatus cordatus is a species of sea urchin in the family Schizasteridae. It is native to shallow seas surrounding certain island groups in the southern Indian Ocean. The body is protected by a hard test or shell which is covered with spines. The female broods its young in deep pockets on the upper surface, retaining the young in place with specialised spines. American zoologist Addison Emery Verrill first scientifically described A. cordatus in 1876.Kroh, A. (2010). Abatus cordatus (Verrill, 1876). In: Kroh, A. & Mooi, R. (2010) World Echinoidea Database. at the World Register of Marine Species

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Abatus cordatus has left across the world's sequence archives.

At a glance

DNA specimens3

BINs2

Marker genes1

eDNA detections1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P696 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Diversity (π)1.5%

Haplotypes1

BINs2

Where individuals differ — all 16 variable positions, in barcode order

142Tvariable

226Cvariable

244Gvariable

256Cvariable

280Tvariable

313Gvariable

337Avariable

346Cvariable

349Cvariable

394Avariable

460Cvariable

502Tvariable

523Avariable

652Gvariable

685Tvariable

691Tvariable

TACTAAACACAAGGATATTGGAACCCTATATCTAGTATTTGGAGCCTGAGCAGGAATGGTGGGGACTGCCATGAGTGTCATTATCCGAGC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Abatus philippiisame genus2.6%Abatus shackletonisame genus3.4%Abatus koehlerisame genus3.5%Amphipneustes similissame order4.0%Abatus cavernosussame genus4.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type982 records

Wild obs. + sensor15

Museum / vouchered967

Range

Area of Occupancy AOO420 km²

Depth

0–200 m sunlit124

200–1000 m twilight7

1–4 km midnight0

>4 km abyssal0

median 30.8 m · max 585 m · 131 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 2

2 georeferenced · 13 without coordinates

Open the mapobservation + sensor15

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy81% within 1 km

≤100 m 11≤1 km 23≤10 km 4>10 km 4

42 georeferenced · 925 without coordinates

Open the institutions mapphysical evidence967

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Paris, FR	57
BASElocation not on record	11
Université de Liègelocation not on record	10
Cambridge, US	6
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	2
CASlocation not on record	2
University of Oslo (UiO)location not on record	1

7 institutions · 89 of 967 vouchered records shown · 432 without an institution code

09Environmental DNA1 detections

Where the DNA of Abatus cordatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.7 °C 19.7–19.7

Seasonal swing summer↔winter15.8 °C

Max temp (day)24.1 °C

Min temp (night)14.6 °C

Precipitation72.4 mm/mo

Air humidity58.0 %

Moisture balance-79.9 mm/mo

Vapour deficit967 Pa

Wind speed4.10 m/s

Cloud cover34.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)