Abagrotis anchocelioides

Guenée, 1852 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Abagrotis

At a glance

Occurrence records133

Data sources5

Biological traits0

DNA specimens14

eDNA detections13

Sources5 archives

Databases and archives Abagrotis anchocelioides's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility133 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF133 records

Environmental DNA1 datasets · 2 countries13 detections

DNA & barcodingBOLD14 specimens

01Narrative

Abagrotis anchocelioides (blueberry budworm moth) is a moth of the family Noctuidae. It is found from southern Quebec to North Carolina, west to southern Manitoba, North Dakota and Missouri. The wingspan is 32–38 mm. Adults are on wing from June to September. The larvae are thought to feed on fruit buds of blueberry, although other sources list the food plants as unknown.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Abagrotis anchocelioides has left across the world's sequence archives.

At a glance

DNA specimens14

BINs2

Marker genes1

eDNA detections13

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus13 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 41 variable positions, in barcode order

82Tmostly conserved

85Tmostly conserved

127Cmostly conserved

142Tmostly conserved

154Tmostly conserved

200Amostly conserved

202Tmostly conserved

205Cmostly conserved

271Amostly conserved

274Cmostly conserved

364Tmostly conserved

379Tmostly conserved

397Cmostly conserved

406Tmostly conserved

412Tmostly conserved

421Cmostly conserved

460Tmostly conserved

539Tmostly conserved

544Amostly conserved

562Cmostly conserved

569Amostly conserved

570Tmostly conserved

573Cmostly conserved

576Tmostly conserved

577Amostly conserved

578Cmostly conserved

580Tmostly conserved

581Tmostly conserved

583Amostly conserved

584Amostly conserved

585Cmostly conserved

586Cvariable

587Gmostly conserved

588Amostly conserved

590Cmostly conserved

591Gmostly conserved

592Amostly conserved

610Cmostly conserved

619Amostly conserved

641Tmostly conserved

653Cmostly conserved

AACATTATATTTTATTTTTGGTATTTGAGCTGGAATAGTAGGAACTTCTTTAAGTTTATTAATTCGAGCTGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.1%

Haplotypes5

BINs2

Most divergent pair3.2%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Abagrotis vittifronssame genus1.7%Abagrotis forbesisame genus2.0%Abagrotis variatasame genus2.0%Abagrotis nefasciasame genus2.0%Abagrotis placidasame genus2.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type133 records

Wild obs. + sensor33

Museum / vouchered100

Range

Area of Occupancy AOO256 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy69% within 1 km

≤100 m 12≤1 km 8≤10 km 2>10 km 7

29 georeferenced · 4 without coordinates

Open the mapobservation + sensor33

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy40% within 1 km

≤1 km 8≤10 km 12

20 georeferenced · 80 without coordinates

Open the institutions mapphysical evidence100

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Alberta Museums (UAM)location not on record	34
Helsinki, FI	14
North Carolina State University Insect Museumlocation not on record	14
East Lansing, US	10
New Haven, US	8
Washington, US	4
University of Guelph, Centre for Biodiversity Genomicslocation not on record	3
Decorah, US	1
SOVTlocation not on record	1
Champaign, US	1

10 institutions · 90 of 100 vouchered records shown · 10 without an institution code

09Environmental DNA13 detections

Where the DNA of Abagrotis anchocelioides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found13

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 13 detections have coordinates

Open the map2 countries0

1. Forest & WoodlandForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.0 °C 12.1–21.8

Seasonal swing summer↔winter28.3 °C

Max temp (day)20.2 °C 16.2–26.8

Min temp (night)13.4 °C 8.20–17.4

Precipitation110 mm/mo 91.4–156

Air humidity61.5 % 56.2–62.5

Moisture balance8.50 mm/mo -26.3–38.2

Vapour deficit705 Pa 614–1,010

Wind speed2.70 m/s 1.80–3.10

Cloud cover46.9 % 27.6–60.4

CHELSA 1981–2010, ~9 km grid, at location & month of 13 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)