Abagrotis nefascia

Smith, 1908 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Abagrotis

At a glance

Occurrence records216

Data sources6

Biological traits0

DNA specimens24

eDNA detections8

Sources6 archives

Databases and archives Abagrotis nefascia's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility216 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics24 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF216 records

Environmental DNA1 datasets · 1 countries8 detections

DNA & barcodingBOLD24 specimens

01Narrative

Abagrotis nefascia is a moth of the family Noctuidae first described by Smith in 1908. It is found in North America from Alberta and British Columbia down through Massachusetts to California. The species is listed as threatened in the US state of Connecticut."Connecticut's Endangered, Threatened and Special Concern Species 2015". State of Connecticut Department of Energy and Environmental Protection Bureau of Natural Resources. Retrieved 19 January 2018.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding24 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Abagrotis nefascia has left across the world's sequence archives.

At a glance

DNA specimens24

BINs2

Marker genes1

eDNA detections8

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus24 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 88% of positions are identical in every specimen.

Where individuals differ — all 76 variable positions, in barcode order

2Amostly conserved

3Cmostly conserved

4Amostly conserved

7Amostly conserved

8Tmostly conserved

9Amostly conserved

14Amostly conserved

15Tmostly conserved

16Tvariable

17Tmostly conserved

20Gmostly conserved

22Tmostly conserved

23Amostly conserved

24Tmostly conserved

26Tmostly conserved

29Gmostly conserved

30Cmostly conserved

31Tmostly conserved

33Gmostly conserved

34Amostly conserved

35Amostly conserved

36Tmostly conserved

38Gmostly conserved

39Tmostly conserved

40Avariable

41Gmostly conserved

42Gmostly conserved

43Amostly conserved

44Amostly conserved

45Cmostly conserved

46Tmostly conserved

47Tmostly conserved

48Cmostly conserved

53Amostly conserved

54Gmostly conserved

55Tmostly conserved

56Tmostly conserved

58Amostly conserved

59Tmostly conserved

60Tmostly conserved

62Amostly conserved

63Tmostly conserved

65Cmostly conserved

66Gmostly conserved

68Gmostly conserved

69Cmostly conserved

70Tmostly conserved

72Amostly conserved

74Tmostly conserved

75Tmostly conserved

76Amostly conserved

77Gmostly conserved

78Gmostly conserved

79Amostly conserved

80Amostly conserved

81Amostly conserved

85Tmostly conserved

115Cvariable

127Cvariable

133Avariable

157Tvariable

205Tvariable

220Cvariable

238Tmostly conserved

388Tvariable

397Tvariable

508Tvariable

542Tvariable

550Avariable

565Tvariable

574Tvariable

610Tmostly conserved

616Cmostly conserved

628Avariable

631Amostly conserved

634Cvariable

AACATTATATTTTATTTTTGGTATTTGAGCTGGAATAGTAGGAACTTCTTTAAGTTTATTAATTCGAGCTGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.9%

Haplotypes3

BINs2

Most divergent pair2.9%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Abagrotis turbulentasame genus1.5%Abagrotis dickelisame genus1.5%Abagrotis forbesisame genus1.7%Abagrotis duancasame genus1.8%Abagrotis herminasame genus1.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type216 records

Wild obs. + sensor33

Museum / vouchered183

Origin

Native2

Range

Area of Occupancy AOO392 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy36% within 1 km

≤100 m 4≤1 km 4≤10 km 9>10 km 5

22 georeferenced · 11 without coordinates

Open the mapobservation + sensor33

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy54% within 1 km

≤100 m 13≤1 km 17≤10 km 19>10 km 7

56 georeferenced · 127 without coordinates

Open the institutions mapphysical evidence183

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Alberta Museums (UAM)location not on record	43
ASUlocation not on record	33
Washington, US	26
Mississippi State, US	16
Oregon State Arthropod Collectionlocation not on record	12
New Haven, US	11
Colorado State Universitylocation not on record	11
Vernal, US	3
Helsinki, FI	2
Los Angeles, US	2
Denver, US	1

11 institutions · 160 of 183 vouchered records shown · 23 without an institution code

09Environmental DNA8 detections

Where the DNA of Abagrotis nefascia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map1 country0

4. Native Grassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.5 °C -4.40–18.5

Seasonal swing summer↔winter23.5 °C

Max temp (day)21.9 °C -1.10–25.1

Min temp (night)10.2 °C -6.50–11.4

Precipitation28.3 mm/mo 21.2–54.0

Air humidity54.1 % 49.0–65.1

Moisture balance-59.2 mm/mo -140–-1.80

Vapour deficit808 Pa 269–1,090

Wind speed3.80 m/s 1.70–5.60

Cloud cover38.5 % 32.1–57.6

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)