Abagrotis duanca

Smith, 1908 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Abagrotis

At a glance

Occurrence records246

Data sources7

Biological traits0

DNA specimens18

eDNA detections2

Sources7 archives

Databases and archives Abagrotis duanca's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility246 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics18 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF246 records

Environmental DNA1 datasets · 2 countries2 detections

DNA & barcodingBOLD18 specimens

01Narrative

Abagrotis duanca is a moth of the family Noctuidae first described by Smith in 1908. It is found in the Pacific Northwest of North America. In Alberta it has been collected only in the extreme southeastern corner. The wingspan is about 28 mm. Adults are on wing from June to July in one generation in Alberta. Reported food plants include Artemisia tridentata.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding18 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Abagrotis duanca has left across the world's sequence archives.

At a glance

DNA specimens18

BINs2

Marker genes1

eDNA detections2

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus15 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 30 variable positions, in barcode order

25Tmostly conserved

58Gvariable

100Amostly conserved

119Amostly conserved

124Tmostly conserved

127Tmostly conserved

133Amostly conserved

165Tmostly conserved

166Amostly conserved

178Tmostly conserved

202Tmostly conserved

206Cmostly conserved

220Tmostly conserved

235Cmostly conserved

250Tvariable

259Tmostly conserved

268Tmostly conserved

313Tmostly conserved

340Tmostly conserved

367Tmostly conserved

400Tmostly conserved

421Cmostly conserved

433Amostly conserved

466Amostly conserved

476Amostly conserved

533Tmostly conserved

586Tmostly conserved

589Tmostly conserved

604Tmostly conserved

619Tmostly conserved

AACATTATATTTTATTTTTGGTATTTGAGCTGGAATAGTAGGAACTTCTTTAAGTTTGTTAATTCGAGCTGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.95%

Haplotypes4

BINs2

Most divergent pair2.6%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Abagrotis forbesisame genus1.5%Abagrotis turbulentasame genus1.8%Abagrotis dickelisame genus1.8%Abagrotis herminasame genus1.8%Abagrotis nefasciasame genus1.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type246 records

Wild obs. + sensor24

Museum / vouchered222

Range

Area of Occupancy AOO496 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy38% within 1 km

≤100 m 3≤1 km 5≤10 km 9>10 km 4

21 georeferenced · 3 without coordinates

Open the mapobservation + sensor24

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy72% within 1 km

≤100 m 45≤1 km 3≤10 km 14>10 km 5

67 georeferenced · 155 without coordinates

Open the institutions mapphysical evidence222

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Alberta Museums (UAM)location not on record	57
Colorado State Universitylocation not on record	49
Vernal, US	32
Oregon State Arthropod Collectionlocation not on record	23
ASUlocation not on record	12
San Diego, US	9
Helsinki, FI	8
East Lansing, US	7
New Haven, US	4
Mississippi State, US	4
WWUlocation not on record	4
St. Paul, US	2
University of California, Davis, Bohart Museum of Entomologylocation not on record	2
Denver, US	1

14 institutions · 214 of 222 vouchered records shown · 8 without an institution code

09Environmental DNA2 detections

Where the DNA of Abagrotis duanca was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.5 °C 17.0–18.0

Seasonal swing summer↔winter21.7 °C

Max temp (day)24.9 °C 24.8–25.0

Min temp (night)11.0 °C 10.4–11.5

Precipitation26.0 mm/mo 25.8–26.2

Air humidity50.3 % 49.3–51.4

Moisture balance-131 mm/mo -137–-125

Vapour deficit1,001 Pa 950–1,052

Wind speed2.80 m/s 2.00–3.60

Cloud cover35.0 % 32.7–37.4

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)