Abagrotis variata

Grote, 1876 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Abagrotis

At a glance

Occurrence records160

Data sources6

Biological traits0

DNA specimens12

eDNA detections11

Sources6 archives

Databases and archives Abagrotis variata's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility160 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF160 records

Environmental DNA1 datasets · 2 countries11 detections

DNA & barcodingBOLD12 specimens

01Narrative

Abagrotis variata is a moth of the family Noctuidae first described by Augustus Radcliffe Grote in 1876. It is found in North America from British Columbia to California, east to New Mexico and Alberta. The wingspan is about 36–42 mm. Adults are on wing from August to September, but may be as early as June depending on the location. The larvae feed on flowering trees and shrubs, preferably willow.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Abagrotis variata has left across the world's sequence archives.

At a glance

DNA specimens12

BINs3

Marker genes1

eDNA detections11

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 23 variable positions, in barcode order

33Gmostly conserved

34Amostly conserved

49Tvariable

55Tmostly conserved

79Amostly conserved

85Tvariable

118Cmostly conserved

127Cvariable

200Avariable

206Tvariable

253Amostly conserved

268Tmostly conserved

277Amostly conserved

283Tvariable

310Avariable

367Cvariable

433Amostly conserved

451Cmostly conserved

496Amostly conserved

577Avariable

586Tmostly conserved

622Amostly conserved

641Cvariable

AACTTTATATTTTATTTTTGGTATTTGAGCTGGAATAGTAGGAACTTCTTTAAGTTTATTAATTCGAGCTGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.5%

Haplotypes4

BINs3

Most divergent pair2.3%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Abagrotis vittifronssame genus1.8%Abagrotis anchocelioidessame genus2.0%Abagrotis nefasciasame genus2.0%Abagrotis turbulentasame genus2.1%Abagrotis dickelisame genus2.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type160 records

Wild obs. + sensor7

Museum / vouchered153

Range

Area of Occupancy AOO340 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 3≤1 km 2≤10 km 1

6 georeferenced · 1 without coordinates

Open the mapobservation + sensor7

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy26% within 1 km

≤100 m 7≤1 km 8≤10 km 42

57 georeferenced · 96 without coordinates

Open the institutions mapphysical evidence153

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Alberta Museums (UAM)location not on record	39
New Haven, US	35
Oregon State Arthropod Collectionlocation not on record	19
Denver, US	10
Vernal, US	7
East Lansing, US	7
St. Paul, US	5
University of Guelph, Centre for Biodiversity Genomicslocation not on record	3
ASUlocation not on record	3
Mississippi State, US	2
Colorado State Universitylocation not on record	2

11 institutions · 132 of 153 vouchered records shown · 21 without an institution code

09Environmental DNA11 detections

Where the DNA of Abagrotis variata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map2 countries0

Riparian Zone

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.4 °C 11.9–21.9

Seasonal swing summer↔winter22.1 °C

Max temp (day)24.6 °C 16.4–30.1

Min temp (night)12.5 °C 8.30–15.1

Precipitation49.1 mm/mo 15.1–73.1

Air humidity52.1 % 45.1–60.2

Moisture balance-89.2 mm/mo -166–15.3

Vapour deficit976 Pa 563–1,470

Wind speed2.60 m/s 1.70–3.30

Cloud cover36.4 % 21.2–43.9

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)