Abagrotis placida

Grote, 1876 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Abagrotis

At a glance

Occurrence records559

Data sources7

Biological traits0

DNA specimens100

eDNA detections100

Sources7 archives

Databases and archives Abagrotis placida's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility559 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI100 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics100 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF559 records

Environmental DNA1 datasets · 2 countries100 detections

DNA & barcodingBOLD100 specimens

01Narrative

Abagrotis placida, the red cutworm, is a species of cutworm or dart moth in the family Noctuidae. It is found in North America. The MONA or Hodges number for Abagrotis placida is 11041.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding100 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Abagrotis placida has left across the world's sequence archives.

At a glance

DNA specimens100

BINs1

Marker genes1

eDNA detections100

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus92 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 15 variable positions, in barcode order

31Tmostly conserved

88Tvariable

163Amostly conserved

206Tvariable

229Avariable

238Tvariable

241Avariable

286Cmostly conserved

361Cvariable

397Cvariable

421Cmostly conserved

542Tvariable

619Avariable

625Amostly conserved

646Cvariable

AACATTATATTTTATTTTTGGTATTTGAGCTGGAATAGTAGGAACTTCTTTAAGTTTATTAATTCGAGCTGAATTAGGAAATCCTGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.5%

Haplotypes10

BIN1

Most divergent pair2.3%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Abagrotis forbesisame genus1.5%Abagrotis vittifronssame genus1.7%Abagrotis duancasame genus2.0%Abagrotis turbulentasame genus2.0%Abagrotis dickelisame genus2.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type559 records

Wild obs. + sensor32

Museum / vouchered527

Range

Area of Occupancy AOO824 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy46% within 1 km

≤100 m 7≤1 km 5≤10 km 12>10 km 2

26 georeferenced · 6 without coordinates

Open the mapobservation + sensor32

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy31% within 1 km

≤100 m 42≤1 km 3≤10 km 97>10 km 3

145 georeferenced · 382 without coordinates

Open the institutions mapphysical evidence527

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Alberta Museums (UAM)location not on record	156
New Haven, US	83
Royal Saskatchewan Museumlocation not on record	42
Oregon State Arthropod Collectionlocation not on record	29
Colorado State Universitylocation not on record	22
Vernal, US	21
Edmonton, CA	20
University of Guelph, Centre for Biodiversity Genomicslocation not on record	17
St. Paul, US	14
Mississippi State, US	10
US	6
Helsinki, FI	5
East Lansing, US	5
Natural History Museum of Utahlocation not on record	4
Washington, US	4
Denver, US	3
University of Alaska Museumlocation not on record	3
WWUlocation not on record	2
Albuquerque, US	1
Decorah, US	1
Brussels, BE	1
RBINS-Scientific Heritagelocation not on record	1

22 institutions · 450 of 527 vouchered records shown · 77 without an institution code

09Environmental DNA100 detections

Where the DNA of Abagrotis placida was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found100

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 100 detections have coordinates

Open the map2 countries0

Forest1. Forest & Woodland | 1.1. Boreal ForestMixed HabitatGrassland1. Forest & Woodland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.7 °C 13.8–19.3

Seasonal swing summer↔winter24.1 °C

Max temp (day)23.2 °C 19.2–26.6

Min temp (night)10.9 °C 8.50–13.5

Precipitation59.8 mm/mo 24.6–88.2

Air humidity52.8 % 49.1–57.7

Moisture balance-79.9 mm/mo -128–-19.9

Vapour deficit884 Pa 695–1,178

Wind speed2.40 m/s 1.30–3.70

Cloud cover34.3 % 31.4–45.6

CHELSA 1981–2010, ~9 km grid, at location & month of 90 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)