Tubuca rosea

(Tweedie, 1937) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Decapoda/Ocypodidae/Tubuca

At a glance

Occurrence records392

Data sources8

Biological traits3

DNA specimens22

eDNA detections22

Sources8 archives

Databases and archives Tubuca rosea's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility375 records↗

OBISOcean Biodiversity Information System17 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI22 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics22 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources3 traits

Occurrence & distributionGBIF · OBIS392 records

Environmental DNA1 datasets · 3 countries22 detections

DNA & barcodingBOLD22 specimens

01Narrative

Tubuca rosea, also known by its common name rose fiddler crab, is a species of crab from the genus Tubuca.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment3

Habitat brackishyes

Habitat saltwateryes

Habitat zonebenthic

05DNA & barcoding22 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tubuca rosea has left across the world's sequence archives.

At a glance

DNA specimens22

BINs1

Marker genes1

eDNA detections22

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P589 bp consensus22 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 14 variable positions, in barcode order

3Cmostly conserved

75Gmostly conserved

105Cmostly conserved

150Amostly conserved

179Amostly conserved

189Cmostly conserved

192Amostly conserved

216Amostly conserved

225Cmostly conserved

249Amostly conserved

285Amostly conserved

327Gmostly conserved

465Amostly conserved

588Cmostly conserved

TCCTTAAGATTAATTATTCGAGCAGAATTAAGTCAGCCAGGAAGACTTATTGGAAACGACCAAATCTACAATGTGGTAGTAACAGCTCAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.68%

Haplotypes8

BIN1

Most divergent pair1.7%

AsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Tubuca paradussumierisame genus9.7%Tubuca dussumierisame genus11.0%Tubuca capricornissame genus11.0%Tubuca forcipatasame genus11.2%Tubuca arcuatasame genus11.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type392 records

Wild obs. + sensor363

Museum / vouchered29

Range

Area of Occupancy AOO524 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy64% within 1 km

≤100 m 84≤1 km 96≤10 km 66>10 km 34

280 georeferenced · 83 without coordinates

Open the mapobservation + sensor363

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced · 27 without coordinates

Open the institutions mapphysical evidence29

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	5
Kyiv, UA	1

2 institutions · 6 of 29 vouchered records shown · 12 without an institution code

09Environmental DNA22 detections

Where the DNA of Tubuca rosea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found22

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 22 detections have coordinates

Open the map3 countries0

Mangrove

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.2 °C 21.3–26.5

Seasonal swing summer↔winter8.20 °C

Max temp (day)26.5 °C 24.5–28.4

Min temp (night)19.7 °C 16.5–25.3

Precipitation15.3 mm/mo 14.0–235

Air humidity54.2 % 53.9–64.5

Moisture balance-88.5 mm/mo

Vapour deficit1,216 Pa 1,115–1,266

Wind speed2.10 m/s

Cloud cover22.2 % 15.2–48.9

CHELSA 1981–2010, ~9 km grid, at location & month of 13 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)