Tubuca arcuata

(De Haan, 1835) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Decapoda/Ocypodidae/Tubuca

At a glance

Occurrence records3 437

Data sources7

Biological traits4

DNA specimens88

eDNA detections88

Sources7 archives

Databases and archives Tubuca arcuata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 101 records↗

OBISOcean Biodiversity Information System336 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI88 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics88 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS3 437 records

Environmental DNA1 datasets · 3 countries88 detections

DNA & barcodingBOLD88 specimens

01Narrative

Uca (Tubuca) arcuata is een krabbensoort uit de familie van de Ocypodidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1835 door De Haan.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits2

Depth max6 m

Depth min0 m

05DNA & barcoding88 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tubuca arcuata has left across the world's sequence archives.

At a glance

DNA specimens88

BINs1

Marker genes1

eDNA detections88

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus88 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 10 variable positions, in barcode order

22Gmostly conserved

74Tmostly conserved

202Cmostly conserved

268Cmostly conserved

271Amostly conserved

412Gvariable

475Cvariable

511Amostly conserved

553Amostly conserved

640Cmostly conserved

TACTTTATATTTTATCTTCGGGGCCTGAGCTGGGATAGTAGGTACATCATTAAGACTAATTATCCGGGCAGAATTAAGTCAGCCAGGTAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 28 commonest of 50 variants.

Diversity (π)0.79%

Haplotypes50

BIN1

Most divergent pair2.1%

AsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Tubuca forcipatasame genus7.1%Tubuca coarctatasame genus9.9%Tubuca capricornissame genus10.5%Tubuca paradussumierisame genus10.8%Tubuca typhonisame genus10.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_058243 ↗ · 13 protein · 22 tRNA · 2 rRNA

COX1COX2ATP8ATP6COX3ND3ND5ND4ND4LND6CYTBND1ND216S ribosomal RNA12S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type3 437 records

Wild obs. + sensor2 731

Museum / vouchered594

Other112

Range

Area of Occupancy AOO2 392 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 1 434≤1 km 469≤10 km 170>10 km 104

2 177 georeferenced · 554 without coordinates

Open the mapobservation + sensor2 731

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2>10 km 1

3 georeferenced · 591 without coordinates

Open the institutions mapphysical evidence594

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Marine Biodiversity Institute of Korealocation not on record	275
Washington, US	19
	9
Kyiv, UA	2
Helsinki, FI	1
Brussels, BE	1

6 institutions · 307 of 594 vouchered records shown

09Environmental DNA88 detections

Where the DNA of Tubuca arcuata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found88

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 88 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.6 °C 12.6–23.6

Seasonal swing summer↔winter27.3 °C

Max temp (day)16.4 °C 16.4–26.8

Min temp (night)7.40 °C 7.40–19.5

Precipitation112 mm/mo 92.3–375

Air humidity58.0 % 58.0–65.0

Moisture balance21.7 mm/mo 19.9–231

Vapour deficit690 Pa 654–1000

Wind speed2.90 m/s 1.00–3.00

Cloud cover41.1 % 39.2–61.9

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Tubuca arcuata

At a glance

Sources7 archives

Habitat & environment2

Other traits2

At a glance

Record type3 437 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions5 of 6 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 437 records